Alexander Palace Forum

Books and Films about the Romanovs and Imperial Russia => Books about the Romanovs and Imperial Russia => Topic started by: Alixz on July 16, 2010, 08:39:37 AM

Title: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on July 16, 2010, 08:39:37 AM
Resurrection of the Romanovs: Anastasia, Anna Anderson, and the World's Greatest Royal Mystery," to be published January 2011
By Greg King and Penney Wilson

A lot of information about this book has been posted under the Anna Anderson threads in "Myths and Legends of Survivors"

I wanted to bring it here because it is going to be a very good book.

It is written by Greg King And Penney Wilson and has been well researched from original sources.

FA has read the manuscript and is recommending it.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on July 16, 2010, 08:43:13 AM
Quote from Greg King about the manuscript


But again...I'd just add that a lot of people still have questions, and I hope that we are able to address. I think (I could be wrong, but this is my perception) that those who still believe that AA was Anastasia are troubled by trying to reconcile the DNA evidence with what we all-everyone-has been led to believe is a mountain of positive evidence on the other side favoring her claim. That's why I can't be too hard on people-because they are assuming in good faith that the AA story passed down to history is so convincing. The most important thing I hope our book will do is to show that almost nothing was convincing and most of what has been said to be evidence in her favor crumbles on close examination. This is the difference between saying, "The DNA says she was FS" and "The DNA says she was FS, now how do you explain everything else in her favor?" The point is, there just isn't much to constitute "evidence" when one gets back to the original documentation and sources. But I understand some people being skeptical because, no matter what they have read on the case, most haven't had the benefit of starting at the beginning of the tale and seeing how thin the evidence in her favor was. I was shocked to find that almost everything I had believed to be true about the case-and evidence in her favor-was actually not correct or plagued with problems. Those discoveries then gave us a sound basis for answering our own outstanding questions-and I hope those of everyone else-so that in the end people can know that AA was Franziska not merely because the DNA says so, but also because of new information and details that help fill in how she managed to seem so convincing.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Joyann1 on July 16, 2010, 07:28:17 PM
I really enjoyed: ''The Fate of the Romanovs '' and ''Gilded Prism''(both were written by the same authors).

When I heard about this book a few month's ago i got really excited, can't wait for it to hit the shelves.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on July 16, 2010, 11:30:52 PM
While we can't discuss too many specifics yet, we are happy to answer any questions that we can with this proviso
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: stepan on July 17, 2010, 08:07:19 PM
I wonder Greg if you had any interview with any member of the Schanzkowski family?   I have always wondered what they knew and what they believed. They have been very silent through the years. I think only Felix daughter has said something. And that was a long time ago now.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on July 17, 2010, 08:31:18 PM
I think we can probably answer this. And the answer is that while we were in contact with members of the family about a decade ago there is nothing worthwhile they could add to the book-and because they are very reluctant to talk we did not pursue this angle. On the plus side, though, you will find in this book about 400 percent more about Franziska than has ever been known before-and a lot of this from her family and friends-siblings and her school chums-whose words and accounts have never appeared in print. In addition there are accounts by her family and many family letters that have not been published before. So hopefully that balances out the lack of any present day collateral relative-in fact none of the relatives have done any interviews with anyone except for Waltraut (Felix's daughter, and thus Franziska's niece, who uses the spelling Waltraut von Czenstkowski), and that only in 1994 for German film producer Maurice Philip Remy. All subsequent accounts that quote Waltraut-in Massie and in Klier and Mingay-derive from this single interview having been translated partially into English and printed in The Times in London in October 1994 in connection with the AA DNA test results.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on July 18, 2010, 09:54:15 AM
Waltraut von Czenstkowski

The addition of 'von' to a name has, in the past, denoted royal heritage.  Is Waltraut claiming to be of royal descent?

I know that this is true in Germany and Austria, but I have not been able to find any information about Polish surnames that would show this to be true in the early 20th century.  Is this something that she has added herself or did you find any information that would show that this particular spelling of the last name was in use by the family when Franziska lived with them?

I have also read that the family did not live in Poland when Franziska was born, but in another part of Eastern Europe (which I can't remember now).

The spelling using the "Cz" is definitely Polish.  Czar being the Polish spelling of Tsar.  Just an interesting note, there is a family near where I live whose last name is Czarczasty.  I have always wanted to know what that translates to and if it is a claim to being a descendant of Russian Royalty, such as Alexander I's brother Grand Duke Constantine, who was governor general of Poland in the late 18th and early 19th centuries.

Similar to FitzRoy in England which would denote being the illegitimate son of a King of England in the 16th century.  Henry the 8th had at least one such son and named him Henry FitzRoy.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on July 18, 2010, 09:15:22 PM
With apologies for not getting too specific at this stage: the family, up to 1914 and onward, used Czenstkowski as the spelling of their name. Franziska changed this, attempting in 1915 to leave behind her eastern origins when living in Germany, and adopted Schanzkowsky. The family had been granted use of the honorific "von" a few hundred years earlier, but it was Franziska's father who finally abandoned it-clearly Waltraut wants it back.

FS was born in West Prussia, and raised in Pomerania. The places are now in modern Poland but at the time of her birth-and for hundreds of years before-had been entirely in German hands.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Ilana on July 19, 2010, 05:31:50 AM
Dear Greg,
I read few books about these things now... just can't anymore, but I really am looking forward to your book.  I am mostly looking forward to knowing WHY she got away with it as long as she did... why so many people were convinced...why she did it...and how, I think finally in the end, she believed it herself...!????

Anyhow, I'm sure we'll find out answers...

Ilana
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on July 19, 2010, 06:45:09 AM
Hi Ilana-hopefully it succeeds on these levels! It really is an attempt to address what we always believed to be true and found was not and at the same time answer any outstanding questions related to the claim
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Constantinople on July 19, 2010, 06:49:56 AM
I thought that von is an aristocratic but not a royal designation.  it is like the French de and means from, in Franz from Munich.  Cz a Polish combination as in Czartoryski.  I am not sure if Czar is originally a Polish form of Tsar but it is closer to the origin of the title, which was Cesar, as in the Roman title.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Constantinople on July 19, 2010, 06:52:34 AM
Cesar=Caesar
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Constantinople on July 19, 2010, 07:00:59 AM
At what point did Gleb Botkin come iinto contact with Anna Anderson?  OPbviously someone who had intimate knowledge of GD Anastasia coached Anna Anderson well.  Was it Gleb?
  No matter how she was discredited and called a fraud,  Anna Anderson's life improved well beyond what a factory worker could hope for.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Constantinople on July 19, 2010, 07:05:42 AM
The word Czar, which English speakers use to refer to the Russian emperors, entered the Russian language as Tsar, the Old Slavic version of Caesar: tsesari. The spelling Czar is a respelling of the Russian word with the letters of the Latin alphabet. The spelling with cz was common in European languages because that was how it was spelled the first time it appeared in a European book in 1549, but the French adopted the spelling tsar in the 19th century and the London Times prefers it. In German it is spelled Zar.

by the way, the German title Kaiser comes from the same and is actually the closest to latin pronounciation as there was no soft c in Latin pronunciation.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on July 19, 2010, 07:06:51 AM
Cz a Polish combination as in Czartoryski.  I am not sure if Czar is originally a Polish form of Tsar

The Polish "Cz" is pronounced "Ch", and used to be more widely used in west Slavic countries - others, though, long ago replaced it with a C with hacek over it (e.g. the spelling Czech persists in English but looks like C<hacek>ech in Czech itself....). "Tsar" in Polish is "Car", with the C being pronounced as "ts". The "Czar" spelling is probably archaic German, inasmuch as the first written source which used it seems to have been by a German[Austrian]/Slovene writer in around the sixteenth century.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on July 19, 2010, 09:17:02 PM
At what point did Gleb Botkin come iinto contact with Anna Anderson?  OPbviously someone who had intimate knowledge of GD Anastasia coached Anna Anderson well.  Was it Gleb?
  No matter how she was discredited and called a fraud,  Anna Anderson's life improved well beyond what a factory worker could hope for.

1927-quite some time after she made her claim. I think many people may be surprised to find precisely how the claim played itself out-wish we could be more specific at this point but unfortunately we can't!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on July 20, 2010, 11:55:43 AM
I am mostly looking forward to knowing WHY she got away with it as long as she did... why so many people were convinced...why she did it...and how, I think finally in the end, she believed it herself...!????

In a way the answers are fairly obvious... Why did she do it? Because she saw her opportunity and took it. Wouldn't it be nicer to be a former grand duchess to whom everyone pays attention, wines and dines, provides room and board, etc., rather than some unknown poor woman with nothing going for you? It's a no-brainer... People were convinced or sort of convinced because they wanted to be convinced, andit made a good story. At the end, she may have been convinced herself, and it didn't hurt that she was clearly mentally ill or at least had some sort of a personality disorder... (even if she knew reality from fantasy). There are many people like this out there, it's really nothing unusual.  This was not the first time in history that a claimant for something or other convinced a bunch of people of his or her own authenticity... Think Perkin Warbeck, The False Dmitri, and a bunch of others like this...  Heck, even some of the more bizarre claimants for Anastasia (and other siblings) had their fair share of followers.. But all this stuff is what many of us had been saying all along right here on this forum while others were arguing the opposite!   ;)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Laura Mabee on July 20, 2010, 12:32:43 PM
At the chance of sounding ignorant, will this book take into account the new remains that were found recently near Koptyaki Forest?
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on July 20, 2010, 09:10:28 PM
Yes Laura-that's covered-but not terribly in depth. The goal of the book is to show-DNA evidence aside and the remains aside-how in fact, after spending so much time getting back to original documents in the case, we found that there was no "there" there, as it were-very, very little evidence believed to be accrued to her favor can, in fact, be held as reliable or stand the test of critical examination.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: rgt9w on July 21, 2010, 11:44:54 AM
Dear Greg:

After all of the research you have done on this topic, I would like to know what your thoughts regarding the impact of the "Anastasia" myth on Russian History? Do you think there would be as much interest in the Romanovs by westerners had the Anna Anderson case not been followed so closely by the press? Certainly, the case caused a great emotional hardship on members of the Romanov family, but do you think in hindsight it has helped perpetuate their memory?

Kind Regards,

Roy
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on July 21, 2010, 12:59:58 PM
Hi Roy and others:

I understand the excitement about Greg and Penny's new book. (I must confess, I too, was excited to read an early draft). but I'm going to ask Roy to pose his excellent question on the Myths & Legends of Survivors section of the Forum because that is where topics about Franziska belong.

Please confine discussions on this thread to the book itself and do not discuss FS herself on this thread. Got it? Also, as a writer myself, please understand that our friend Greg has the right to not reveal his entire soon to be published work on this Forum. Once ROTR is published, I'm sure he will reveal more.

Now, back to topic, please.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: rgt9w on July 21, 2010, 01:08:52 PM
Hi Lisa,

Thank you for redirecting my question to the proper place. I apologize for straying off topic regarding the book. It sounds like this is going to be another great book from Mr. King and Ms. Wilson.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on July 21, 2010, 04:30:18 PM
Greg,

I just want to say that I am glad to see that you and Penny Wilson finally came to the correct conclusion about Anna Anderson (after all that extremely unpleasant AA warfare, hostility, accusations, etc., which went on for several years), and are now able to admit that you were wrong all along. That takes some valor. I may even read your book now!  ;)

One thing I was wondering was if Peter Kurth has accepted all this about AA/FS, or does he still hold on to his "belief" in her? What does he think about your upcoming book, if anything?
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on July 21, 2010, 05:18:02 PM
Greg,

I just want to say that I am glad to see that you and Penny Wilson finally came to the correct conclusion about Anna Anderson (after all that extremely unpleasant AA warfare, hostility, accusations, etc., which went on for several years), and are now able to admit that you were wrong all along. That takes some valor. I may even read your book now!  ;)

One thing I was wondering was if Peter Kurth has accepted all this about AA/FS, or does he still hold on to his "belief" in her? What does he think about your upcoming book, if anything?

Ill though it behoves me to rush in and say something which sounds like "hey - no valour involved!" I am going to point out that I did tell you back in 2008 that Greg had had no intention of writing a book about AA since about 2003, and the constant dramas people engaged in were an irritating distraction while he was working on the books he did do. Maybe now you might believe me!!.....and Greg will tell you that PK's views are his own, which he's entitled to, just like anyone else's are. No-one speaks for anyone else.

I told you this too, I am sure: that I have known Greg change his mind constantly about any number of historical isues; it's what historians do and I would hope that anyone who claims that label would do the same; no big deal.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on July 21, 2010, 05:37:16 PM
That's great! I'm glad to hear it.  

Of course I know that PK's views are his own, why wouldn't they be, which is why I was curious about what PK's view is at this point about Anna Anderson, if he changed his mind as well or not, based on the additional evidence that Greg found about AA/FS, which this new book is based on. I figured if anyone would know, it would be Greg, which is why I asked. If he doesn't know or doesn't want to say anything about that, that's ok too!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on July 21, 2010, 07:10:36 PM
No-one speaks for anyone else.

P.S. Should you be speaking for Greg then?  Unless he asked you because he doesn't want to speak to me... ?? Which is ok too.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on July 21, 2010, 08:14:20 PM
Greg,

I just want to say that I am glad to see that you and Penny Wilson finally came to the correct conclusion about Anna Anderson (after all that extremely unpleasant AA warfare, hostility, accusations, etc., which went on for several years), and are now able to admit that you were wrong all along. That takes some valor. I may even read your book now!  ;)

One thing I was wondering was if Peter Kurth has accepted all this about AA/FS, or does he still hold on to his "belief" in her? What does he think about your upcoming book, if anything?

I have absolutely no problem in speaking to you Helen. What I cannot tell you, though, is anything that Peter may think. He was extraordinarily helpful as we researched every aspect of this case, but although he obviously knows of our decision and some of the evidence we have uncovered, we are unaware of his position or if his views have changed. Ours certainly have, but only after-as I have pointed out-we were able to get back to the heart of the claim and the original documentation from the 1920s. Actually I think you may find the book worthwhile, for it completely destroys much of what everyone-whether they were pro or anti-AA-believed to be true in her case-and with very firm, footnoted and documented evidence from the Staatsarchiv in Darmstadt that has never before been published.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: imperial angel on August 08, 2010, 07:02:36 AM
At what point did Gleb Botkin come iinto contact with Anna Anderson?  OPbviously someone who had intimate knowledge of GD Anastasia coached Anna Anderson well.  Was it Gleb?
  No matter how she was discredited and called a fraud,  Anna Anderson's life improved well beyond what a factory worker could hope for.

First off, I'm very excited to hear about this new book by King and Wilson. I know this is a bit off topic for this thread, but a book that has I recall- I read it awhile ago now- some info on the Gleb Botkin/ AA thing, is At the Court of Anna Anderson, a book published in 2007 or so. If you haven't read it, Constantinople, you should. I myself didn't think all that highly of that book but I recall it mentions Gleb Botkin. Sorry for going off topic..
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on November 30, 2010, 09:28:49 PM
Just a quick note: The book has been moved up-it is now scheduled for release on December 21, so in another 3 weeks. Amazon has it available for Christmas delivery, so presumably it should be arriving in stores in another couple of weeks. Just wanted to let everyone know.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Vecchiolarry on December 01, 2010, 10:36:11 AM
Hi Greg and Penny,

In 2007 at the Eurohistory Conference, Penny gave a very interesting talk on several Russian noble girls, who disappeared with the revolution.
I think it would be most interesting if she or both of you could do a small book or expand article(s) on these and any others who remain unaccounted for.
Perhaps an article in Arturo's magazine or Ted's magazine.  Or perhaps, "Majesty" if you have connections there and if they're intersted.

I think this would be a very educational & informative venture for you both.  I was most taken with Penny's lecture then!!

"Just a small word in your ear"....

Cheers to both,
Larry
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 01, 2010, 10:52:23 AM
Quote
The book has been moved up-it is now scheduled for release on December 21, so in another 3 weeks. Amazon has it available for Christmas delivery, so presumably it should be arriving in stores in another couple of weeks. Just wanted to let everyone know.

I hope the release date has been moved up in Canada as well.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: koloagirl on December 02, 2010, 07:43:06 PM

Aloha all!

Well, I just pre-ordered it last week thru Amazon.com and they were promising a December 21st delivery as I recall - so maybe I'll get it as a Christmas present - to myself!

Can't wait!  The King-Wilson books always take pride of place in my Romanov bookshelf!

Mahalo!
Janet R.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Ilana on December 09, 2010, 10:05:39 AM
Going to order as well...this topic so intrigues me!!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on December 09, 2010, 10:19:09 AM
Is the British version coming out on 21 December as well?

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 09, 2010, 08:14:59 PM
I am not sure about the UK-the US is definite. If there is any delay in the UK it won't be more than say 2 weeks after US publication.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 10, 2010, 11:27:01 AM
What about Canada?
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 10, 2010, 03:58:59 PM
Canada should be the same as US-December 21!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 10, 2010, 04:02:02 PM
Ah, that's good to know.  It will make a great Christmas present.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on December 15, 2010, 11:11:00 PM
My copy arrived today!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 15, 2010, 11:25:57 PM
Hopefully that means mine will be arriving soon.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: koloagirl on December 16, 2010, 05:27:19 PM

Aloha from Kaua'i!

My copy from Amazon came today in the mail - hooray!!

And I live all the way in the middle of the Pacific - so I'd think mainland folks would be getting theirs pretty quickly!!

Can't wait to dive in!

Malama Pono,
Janet R.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Georgiy on December 17, 2010, 03:24:35 PM
Then maybe there is hope that my copy will arrive way down in the South Pacific before long!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Robert_Hall on December 17, 2010, 05:02:50 PM
I received my copy on Monday (13th). Barely stared it, but looks good, as King & Wilson books usually are.  Excellent research. I will try to finish it this weekend, before the holidays really take over!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: koloagirl on December 17, 2010, 06:59:38 PM

Aloha all!

That is my plan as well Robert!

Mele Kalikimaka (Merry Christmas)!

Janet R.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Dominic_Albanese on December 18, 2010, 06:31:54 PM
OMG!  I didn't know it was shipping!  Off to find out where my copy is!

dca
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on December 19, 2010, 01:17:47 PM
My copy is next to my elbow.

I can't wait to steal some time during this holiday season to read it.

Happy Holidays everyone!

AGRBear
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alice on December 19, 2010, 05:52:51 PM
My copy is next to my elbow.

I can't wait to steal some time during this holiday season to read it.

Happy Holidays everyone!

AGRBear

Same! (Well, except mine isn't next to my elbow).

Happy Holidays to all.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Laura Mabee on December 19, 2010, 06:43:08 PM
What about Canada?
As of last Friday, Amazon.ca sent out my copy! I should be receiving it by tomorrow (according to my tracking number)

: D
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 19, 2010, 09:09:13 PM
We hope you all enjoy it!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 20, 2010, 01:03:17 AM
Hopefully, my copy will be delivered to Chapters this week. 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Griae on December 20, 2010, 12:31:18 PM
Unfortunately, my copy (ordered at amazon.co.uk) will not arrive untill the half of January. I hoped to get the book before the Christmas Holidays, but I am afraid it will be a little bit later. Oh well, I have something to look forward to.

greetings, Bettina
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on December 20, 2010, 02:22:42 PM
I got my copy on Thursday and finished the book Sunday morning and posted my review on Amazon.com last night. I really loved it!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 21, 2010, 11:58:13 AM
Mine still hasn't arrived.  Hopefully this week...
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kimberly on December 23, 2010, 02:33:42 AM
Mine's here now at last. Looks good and "meaty".
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Eric_Lowe on December 23, 2010, 12:56:57 PM
Thanks Greg ! I think we need closure on this case as lots of people believe in Anna Anderson (from Grand Duke Andrei of Russia, Princess Xenia of Russia, Prince Sigsmund of Prussia, Crown Princess Cecilie of Prussia...etc) and the escape. Even Sandro wrote that she must bewitched by the ghost of Anastasia to know so much information about the Romanovs. I look forward to close the chapter to this mystery.  :)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 23, 2010, 04:23:20 PM
Hello, people!:

                        I had promised to myself to never mix up in a new discussion here, since I was a little tired of reading I was a nut, I had delusion about claimants , I was a romantic and so on. I was on Anna Anderson's side and everyone knows it at the board, at least, the old members. But I think it's the moment to popping out again  ;D and state my position.

                       Foreign books are too expensive for me to purchase right now, but when I could read read the last Penny and Greg's work I'm almost sure I will be convinced about AA being FS.I said it for I read the messages of people who was very reluctant to accept AA as FS, just like myself  and they all saids that all their questions have been answered.If a so inquisitive mind as Bear accepted it , I think the case is now closed. I've once said that IF all the answers I had were answered by documents, I'll change my mind, and IF this book does, I sure will. The fact that AA wasn't Anastasia doesn't avoid my own life to go ahead (as I've said a lot of times to). In fact (another thing I used to say over and over), this ending of all the family of the Tsar at the same time in the basement of Ypatiev House, destroyed by a group of bloody revolutionaries fits much better with my own political ideas than an Anastasia hypothetical surviving. That's the reason for the explanation Helen gives us about "people wanting her to be Anastasia" doesn't works in my case. I DIDN'T want Anna Anderson being Anastasia. I'd rather like her being killed along with her family. It was more "romantic" than a traumatic surviving of a poor girl denied by her own family, always alone and struggling to have her own identity. This is not my idea of romanticism. The problem was the first time I saw AA's pic in a newspaper, along with a picture of Anastasia. My eyes went wide open and I say to myself: "Heck! But it is she!" . And since this very moment, I became AA's supporter, even before reading Peter Kurth's book. Even now it's hard to me not to see Anastasia into this woman eyes...I struggled for years with my wanting of GD Anastasia dying along with her family and what my eyes would see every time that someone published a pic of her. I didn't want AA to be Anastasia, but my eyes would said otherwise.

                          Then, I read Blair Lovell's and Kurth's books and I become 100% certain about AA being ANR.I didn't know how much evidence was in her favor, so, if before I was almost certain of AA being ANR, now I was able to kill myself before accepting she was FS, a person who was depicted as the exact opposite of AA herself.DNA must be lying. Even friends of mine who are scientist said me it was possible to fake it (and I still believe it, even if AA turned to be FS). I was also told that her accent was not Polish at all but Russian ) (a friend of mine who is Polish said me so), and that FS pics were heavily retouched. The people who said me these things were not connected in any way with the x case and didn't care a bit for someone being Anastasia or not. So, when Penny and Greg  informed that they were working in a new book about claimants I never imagined they will discover that AA was really FS. For me, I repeat it, it's a  very unexpected solution to the case.

                           It seems that, after all, I could breath again. Anastasia seems to have died with her beloved family and didn't suffer all the cruelties she must have if AA had turned to be her. Aunt Olga was not a bad woman. I was very saddened all the time I believed in AA's claim, for I couldn't understand WHY a so good woman I liked very much was able to do that to her beloved Malenkaya. This was one of the things that bothered me terribly about this case....

Merry Christmas to you all!!!
RealAnastasia.

                               Merry Ck
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 24, 2010, 03:45:34 AM
Real Anastasia - I had never thought that surviving the murder would have been more horrible than being killed with the family.  That is a point of view that is new to me.

However, I think you have a good point.  It makes much more sense for the survivors of the Imperial Family to reject an impostor than to be "bad people" who would reject their own beloved Anastasia for the sake of money or power or pride.  It follows that Grand Duchess Olga would have done anything to accept her niece not ignore her.

Many would think that the "romance" would be in believing that Anastasia survived.  I have never believed that the woman who claimed to be Anastasia could really be the Grand Duchess.  That woman was slovenly and ill mannered and rude.  I could never believe that the real Anastasia would have sunk to that level, no matter how much she had suffered had she survived.  Anastasia was not a "child" at the time of the murders with no training, education, or sense of self worth.  The real Anastasia would have been 17.  Far to old to act like a the spoiled "brat" that Grand Duchess Olga and others found Anna Anderson to be.

I have not yet read the new book by Greg and Penney and so I can not comment of what they have said.  However, if the "final chapter" is now being closed, I hope that what they have found brings comfort to everyone and the truth to all.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on December 24, 2010, 09:04:28 AM
RealAnastasia

I came to Anna Anderson from the opposite direction, having begun as a sceptic and remained so. The whole story of her 'escape' seemed so inherently improbable.  What interests me now is how someone who, to my eyes, didn't look at all like Anastasia, managed to convince so many people for so long. That is why I am looking forward to reading the book.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Ilana on December 24, 2010, 10:10:58 AM
I received my copy yesterday and have started.  As usual, Greg and Penny are about as thorough as it is possible to be and leave the rest of us in the dust!!

I look forward to their answers.  It struck me that Robert Massie said that there need not be more books on the subject...this is a case closed event!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 24, 2010, 11:07:35 AM
RealAnastasia

I came to Anna Anderson from the opposite direction, having begun as a sceptic and remained so. The whole story of her 'escape' seemed so inherently improbable.  What interests me now is how someone who, to my eyes, didn't look at all like Anastasia, managed to convince so many people for so long. That is why I am looking forward to reading the book.

Ann

The story of her "escape" was not so improbable for me. Argentina is a country of European immigration, and a lot of people who settled here, having suffered WWI and WWII escaped more miraculously than the story AA told to her supporters. I knew an old man (now dead) that had received a bullet in his head and had been lying under several corpses for some two hours. The murders (in this case, Russian soldiers at WWII), believed they had killed him. He waited until they went away, and then almost dead but not dead, reached a  house, where he was helped. The bullet had not entered in his brain, but only to the surface tissue.  He was cured by a doctor. he had the face almost all smashed a had some bullets in other parts of her body. He was hidden and healed, and then, his brother and him went half walking, half in charriot trying to reach France's borderline, what they did. They lived poorly and after a while, they took a ship and settled in Buenos Aries.

No; AA's "story" COULD have happened. But is just that it never happened.All that she stated could have been the way she did; it just WASN'T.

RealAnastasia,.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 24, 2010, 11:34:15 AM
Real Anastasia - I had never thought that surviving the murder would have been more horrible than being killed with the family.  That is a point of view that is new to me.

However, I think you have a good point.  It makes much more sense for the survivors of the Imperial Family to reject an impostor than to be "bad people" who would reject their own beloved Anastasia for the sake of money or power or pride.  It follows that Grand Duchess Olga would have done anything to accept her niece not ignore her.

Many would think that the "romance" would be in believing that Anastasia survived.  I have never believed that the woman who claimed to be Anastasia could really be the Grand Duchess.  That woman was slovenly and ill mannered and rude.  I could never believe that the real Anastasia would have sunk to that level, not matter how much she had suffered had she survived.  Anastasia was not a "child" at the time of the murders with no training, education, or sense of self worth.  The real Anastasia would have been 17.  Far to old to act like a the spoiled "brat" that Grand Duchess Olga and others found the Anna Anderson to be.

I have not yet read the new book by Greg and Penney and so I can not comment of what they have said.  However, if the "final chapter" is now being closed, I hope that what they have found brings comfort to everyone and the truth to all.

Sorry, but Anna's behavior was one of the things that convinced me the more about
her identity. Anastasia was depicted like an "enfant terrible" and when I read some of Anna's answer to her friends and letters, etc, etc it was quite clear to me that it was our spunky "Imp" who was hiding behind these phrases. Sometimes, she was rude and haughty, but I don't find this so awfully odd, for she claimed she had survived a great tragedy. If my family had been killed right before my eyes, I should be quite crazy. Other thing that put me in Anna's side was precisely this kind of behavior : an impostor  would not treat her supporters in a such rude way if she was really an imposter. If I was myself an imposter, I think I should be nice to my supporters, trying to have a glamorous life and profiting my connections to high class to have a great time with them (Oh, yes! Be sure of it! :D). I should not have lived in an old barrack in Untenlenghenhardt   , rejecting journalist, not wanting to see anyone and starving myself. That was rather absurd...These are the main reasons (adding to the facial features), for I was an AA supporter. If she was an impostor, she'll try to be nice to people and show to others as the lost princess she claimed to be. This case is the weirdest in the world...An impost er, who doesn't acted like an imposter but who was after all, an imposter...

Yes. Really weird.
RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Eric_Lowe on December 24, 2010, 02:49:41 PM
I just started reading the book in a zig-zag fashion and got through quite a lot of it. It was very well researched and written. Greg King & Penny Wilson must be proud on what they accomplished. I am satisfied that Anna Anderson was not Anastasia based on the facts and the DNA and the hair sample (which is after all Greg's own evidence). However I am not so convinced about Gaillard and Ernie of Hesse. Most certainly the German language and him burning his own research material calls to question his motives...Ernie's vendetta corners on to whether he visited Russia during the war. It seems like it is now generally accepted now that a trip may have been taken place. Based on the testimony on both sides (German & Russian). It is a fact that Greg King shied away from because he was working in Darmstadt (and do not want the door to his research closed). I don't think Anna got this as "gossip" as indicated in the book, she was very convinced of it. It is very interesting that both Ernie and VMH did not meet up with Anna and unmask her in person. That led to the fact that they were afraid that it "might be" really Anastasia. Irene, who met her had doubts until the end. I found the reactions of the royals towards this case more interesting than Anna Anderson herself. I think maybe another book is needed to clear out the loose ends. This book has put Anna back into Franciska. All and all, a book not to be missed.  ;)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 24, 2010, 03:32:03 PM
I just started reading the book in a zig-zag fashion and got through quite alot of it. It was very well reaserched and written. Greg King & Penny Wilson must be proud on what they accomplished. I am satifised that Anna Anderson was not Anastasia based on the facts and the DNA and the hair sample (which isafter all Greg's own evidence). However I am not so convinced about Gaillard and Ernie of Hesse. Most certainly the German language and him burning his own research material calls to question his motives...Ernie's vandetta corners on to whether he visited Russia during the war. It seems like it is now generally accepted now that a trip may have been taken place. Based on the testimony on both sides (German & Russian). It is a fact that Greg King shied away from because he was working in Darmstadt (and do not want the door to his research closed). I don't think Anna got this as "gossip" as indicated in the book, she was very convinced of it. It is very interesting that both Ernie and VMH did not meet up with Anna and unmask her in person. That led to the fact that they were afraid that it "might be" really Anastasia. Irene, who met her had doubts until the end. I found the reactions of the royals towards this case more interesting than Anna Anderson herself. I think maybe another book is needed to clear out the loose ends. This book has put Anna back into Franciska. All and all, a book not to be missed.  ;)

 

   You've said it, Eric! I share 100% your opinion. There are a lot of things who need to be cleared up. We already knows that AA was Franziska (I don't read the book but it seems certain she was), but it should be interesting to made some research about Anastasia's family reactions when AA surfaced. No doubt about Auntie Olga. She was a greast person. The best of the Romanovs, I think. But I suppose that other reactives could have thought that AA could have been Anastasia and wouldn’t acknowledge her as so. I never understood why Ernest didn’t travel to Berlin to unmask AA in person. Most of her enemies had never seen AA in their whole lives. Happily for them, it turned out that she was not Anastasia, but just think it were the opposite…

Irene’s reaction makes me sad, for she seemed doubteous at the end. She even cried saying something over the lines of: “She is similar, she is similar. But what’s the matter if it is not she ?”  What a drama…What a tragedy…

RealAnastasia.
       
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 24, 2010, 09:24:16 PM
Real Anastasia - I had never thought that surviving the murder would have been more horrible than being killed with the family.  That is a point of view that is new to me.

However, I think you have a good point.  It makes much more sense for the survivors of the Imperial Family to reject an impostor than to be "bad people" who would reject their own beloved Anastasia for the sake of money or power or pride.  It follows that Grand Duchess Olga would have done anything to accept her niece not ignore her.

Many would think that the "romance" would be in believing that Anastasia survived.  I have never believed that the woman who claimed to be Anastasia could really be the Grand Duchess.  That woman was slovenly and ill mannered and rude.  I could never believe that the real Anastasia would have sunk to that level, not matter how much she had suffered had she survived.  Anastasia was not a "child" at the time of the murders with no training, education, or sense of self worth.  The real Anastasia would have been 17.  Far to old to act like a the spoiled "brat" that Grand Duchess Olga and others found the Anna Anderson to be.

I have not yet read the new book by Greg and Penney and so I can not comment of what they have said.  However, if the "final chapter" is now being closed, I hope that what they have found brings comfort to everyone and the truth to all.


Funny but about the least of my own personal objections to her having been Anastasia would have to do with her personality. I can imagine a surviving Anastasia, coming from that environment, with those autocratic parents, and surviving the shooting of her family, turning out EXACTLY like AA did-difficult, moody, rude, and all in all disagreeable. Of course this demeanor that AA possessed played, for so many, into the idea that she simply HAD to be genuine as why would a claimant NOT try to do everything to be cooperative. But as we outline, AA had very real reasons NOT to cooperate, lest she be exposed as Franziska.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 24, 2010, 09:30:17 PM
I just started reading the book in a zig-zag fashion and got through quite alot of it. It was very well reaserched and written. Greg King & Penny Wilson must be proud on what they accomplished. I am satifised that Anna Anderson was not Anastasia based on the facts and the DNA and the hair sample (which isafter all Greg's own evidence). However I am not so convinced about Gaillard and Ernie of Hesse. Most certainly the German language and him burning his own research material calls to question his motives...Ernie's vandetta corners on to whether he visited Russia during the war. It seems like it is now generally accepted now that a trip may have been taken place. Based on the testimony on both sides (German & Russian). It is a fact that Greg King shied away from because he was working in Darmstadt (and do not want the door to his research closed). I don't think Anna got this as "gossip" as indicated in the book, she was very convinced of it. It is very interesting that both Ernie and VMH did not meet up with Anna and unmask her in person. That led to the fact that they were afraid that it "might be" really Anastasia. Irene, who met her had doubts until the end. I found the reactions of the royals towards this case more interesting than Anna Anderson herself. I think maybe another book is needed to clear out the loose ends. This book has put Anna back into Franciska. All and all, a book not to be missed.  ;)

Thanks for the kind words. On Ernie, I would simply say that had we actually uncovered PROOF of his alleged 1916 trip we certainly would have included it, despite the fact that we were working so closely with the Staatsarchiv. We didn't. I think what appears in the book is as close to the truth on this as we are likely to come: it wasn't the "trip" but rather the contention that AA's claim showed "intimate knowledge" that is what was important-and with so many people coming forward to say, "Oh, we ALL knew about it," it could scarcely have been an intimate Imperial secret. Whether it took place or not-and I don't know-there is nothing in the claim that shows AA "knowing" something she should not have.

Ernie never met her because his sister did and denounced her and, let's face it, this is a guy so emotional that his wife and family lied to him for a year about Ella's death. Throwing Ernie into a meeting with AA would have been like asking him to sit down to dinner with Yurovsky. He simply avoided it on the word of Irene, who I am sure DID harbor some doubts, as did many people on both sides-they simply kept changing their minds, certain one day, uncertain the next. This is why AA's case became so intriguing-it was never quite as black and white as people wanted it to be.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on December 25, 2010, 04:50:46 AM
'Irene’s reaction makes me sad, for she seemed doubteous at the end. She even cried saying something over the lines of: “She is similar, she is similar. But what’s the matter if it is not she ?”' 

I'm not surprised that both Olga and Irene were uncertain. They were both kind-hearted people who would, I'm sure, have been delighted if someone had survived Ekaterinberg. By the time either of them met Anna Anderson, she had amassed a lot of knowledge and supporters, certainly enough to make a person wonder whether she really could have been Anastasia.

As to the improbability of the escape story, a good part of my reason for doubt is that there was no reason to go to Berlin anyway. The Czech Legion reached Ekaterinberg only a week after the massacre and remained in possession of the city for almost a year. Though a former guard at the House of Special Purpose would wish to get his head down, it would have been possible to get Anastasia to a hospital while she recovered and then leave Russia by the Trans-Siberian Railway, then under White control, as a lot of refugees did.

Ann 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Ilana on December 25, 2010, 10:26:42 AM
I would also state that Greg and Penny would not have shied away from putting research into their book even if it did not please someone at the Darmstadt Archives.  I did not ask Dr. Franz about it because I didn't NEED to.  This, however, was their topic, if they found something that was "controversial" in any way...again, they would not hesitate as credible historians to use it.

What Greg says about Ernie is of course what I have concluded as well, though Ernie is more his field than mine. The "sisters" kept Ernie in cotton wool most of his life.  He was indeed the emotional and fragile one with abandonment issues.  They did keep the details of Ella's death from him as long as possible, knowing, of course he would learn the truth in newspapers.  I have never read any letters that he wrote to Irene or VMH castigating them for not telling him the absolute truth.  It seems to me there was a gentle conspiracy to make sure that Ernie was never too distressed.

VMH left the AA issue up to Irene and had no reason to doubt her.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 25, 2010, 12:43:38 PM
I can see trying to get to a close relative.  I can not see wandering around Europe possibly marrying or not and giving birth to a baby or not and then leaving it.

The whole thing from beginning to end made no sense.  Of course it was not a true story and so of course it didn't make sense.  I think I would have assumed, if I had survived, that someone in my family would want me to contact them and I would, of course, want to "go home".

I would not have been remote, uncouth, without the manners that I was brought up with.  Anastasia may have been an "Imp", but being an Imp in the protected atmosphere of the palace around those who would love and forgive her, is not the same as alienating all who might be able to help a stranded survivor.  To me the alienation is what Greg just referred to.  A way to keep those who might actually be able to expose her away so that she could pretend to be someone she was not.  FS knew that anyone who got too close would find out the truth and expose her for the impostor she was.

I still believe that the real Anastasia would not have devolved into the person that Anna Anderson was.  And that is why, no matter what book I have read, I have never been entirely able to buy into AA being AN.  Especially after she married Manahan.  There was no reason to live in filth and squalor after she had a believing protector in the man she married.  That just never made sense and by that time, she had gathered enough information from gossip and magazines and books and hearsay to make the world believe that she was someone she was not.

But what I believed during the last 50 or so years that I have been reading about the Imperial Family and their way of life and their deaths doesn't truly matter.  The truth is that AA was not AN and now Greg and Penny have written about it.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 25, 2010, 06:25:10 PM
Quote
Especially after she married Manahan.  There was no reason to live in filth and squalor after she had a believing protector in the man she married.  That just never made sense and by that time, she had gathered enough information from gossip and magazines and books and hearsay to make the world believe that she was someone she was not.

Apparently, they lived like that to, in their own words, throw off KGB assassins.    It was either part of her act, or, as she got older, AA actually began to believe her own lie.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 26, 2010, 01:35:55 AM
But just remember that Jack Manahan also believed he'll be killed by KGB. I don't know if AA believed she really was Anastasia or not...but that Jack was certain of it and became almost crazy supposing everybody was against his wife.

I'm not sure AA acted so rude to people fearing she'll be discovered as FS. She was mean toward people who believed her claim and in little things not concerning her identity. She was agressive toward people around little details like the meal was not 100% O.K, or because she had fell in the bathroom, or this or that...These were the details that made me believe for so many time she was AN. An imposter had no reason to be so agressive to people who was kind to her. It could be understable that she acted agressive when a person would come to establish her identity - she was not AN - but what was the sense to act rude toward people who was deboted to her and never doubt about her identity? Nonsense...

Other thing that always puzzled me is the rage AA showed when Doris Wingender recognized her at Seeon Castle. AA seemed perfectly capable to hide her emotions when something could turn badly for her. She acted as the best of the actress when his own brother, Felix, surfaced and, at first saids: "This is my sister, Franziska". She acted as if she hadn't see him in her whole life! How couldn't she control herself when Doris appeared at Seeon? Did the book cover this issue?

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 26, 2010, 01:42:17 AM
Quote
I'm not sure AA acted so rude to people fearing she'll be discovered as FS. She was mean toward people who believed her claim and in little things not concerning her identity. She was agressive toward people around little details like the meal was not 100% O.K, or because she had fell in the bathroom, or this or that...These were the details that made me believe for so many time she was AN. An imposter had no reason to be so agressive to people who was kind to her

It was part of the act.  People would think:  "Why is she being mean to those who want to help her?  A real imposter would go out of their way to be nice.  Since she's not doing that, she MUST be Anastasia!"  And it worked, this convinced many people she was AN, not FS.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on December 26, 2010, 03:38:17 AM
To my mind the unpleasant behaviour and living in squalor came from Anna Anderson's mental illness.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 26, 2010, 05:23:01 AM
Other thing that always puzzled me is the rage AA showed when Doris Wingender recognized her at Seeon Castle. AA seemed perfectly capable to hide her emotions when something could turn badly for her. She acted as the best of the actress when his own brother, Felix, surfaced and, at first saids: "This is my sister, Franziska". She acted as if she hadn't see him in her whole life! How couldn't she control herself when Doris appeared at Seeon? Did the book cover this issue?

RealAnastasia.

We do. And actually when she came face to face with Felix she did NOT, contrary to what has previously been written, behave as if it was nothing. The Duke of Leuchtenberg's two daughters recalled that when she spotted Felix she "became very agitated, and her jaw trembled through the whole of the meeting." So she wasn't terribly adept at disguising her feelings.

As for her reaction to Doris: this was the same day that the Berliner Nachtausgabe broke the unmasking story, and at the time of the meeting AA had no idea she had been discovered. So suddenly into her rooms comes Doris-right out of a past she was trying to escape, forget, and erase. I think it's easy to imagine what was going on in AA's mind when that happened.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 26, 2010, 05:28:10 AM
To my mind the unpleasant behaviour and living in squalor came from Anna Anderson's mental illness.

Ann

Maybe. The problem is no one will ever be able to accurately address her mental state in these years from 1968-1978 when things really started to go downhill. Being around the eccentric Jack didn't help AT ALL. But don't forget that there may be something else at work here: she was, after all, a farm girl, poor as things go (not impoverished, though), so the hoarding of possessions, etc., may owe something to those early years when the family did struggle, before Anton inherited his father's farm. You see that kind of behavior today with hoarders, especially people who lived through difficult times early on.

Other peculiarities though-like her passion for animals, cats, and cremating her pets in the fireplace-that all traces back to Kachubian folklore, where they believed in reincarnation into animals and a lot of other odd bits that she began to openly display in her years in Charlottesville.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 26, 2010, 11:26:23 AM
Back in the 1970's, there was this show, In Search Of (hosted by Leonard Nimoy) and they did a segment on Anastasia.  At the time, Jack and Anna Manahan were still alive, and they interviewed them.  Jack did most of the talking.  Anna said something like "Either you believe or you don't believe."

Of course back then there was still room for doubt.  However, one thing that I noticed was that Anna struggled with the English language, while the real Anastasia was fluent in it.  I wonder if anyone else picked up on this.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Eric_Lowe on December 26, 2010, 12:39:01 PM
Thanks Greg. I think the thing about Anna Anderson is that she had so many lucky breaks. Her knowledge and those info screened by her supporters made it hard for people to believe she was false. Those who reconized her included Princess Xenia Georgievna, Grand Duke Andrei of Russia and his wife Mathilde (Mistress of Nicholas II), Crown Princess Cecilie of Prussia (whose mother was a Romanov), Prince Sigismund of Prussia (son of Princess Irene of Hesse, sister of the Tsarina), Princess Vera Constantinova, Crown Princess Martha of Norway, Lili Dehn (close friend of the Tsarina)...Could all of them be wrong ? Also remember both (Irene & Olga who met Anna was not convinced but wasn't absolutely sure at the end). So most of those who were against her never actually met her (Grand Duke Ernst of Hesse, VMH, Dickie Mountbatten, Barbara of Mecklenburg & Grand Duke Kyrill of Russia). It make people think why did they not go unmask her themselves ? A face to face with Anna could do the trick (Irene did so with Eugenie Smith), were they afraid that they may be brought around to believe her story ? The German language story did a lot of harm to those who believe her to be false (Gibbes, Gaillard & Countess Sophie knew that Anastasia spoke & learn German till the end. why did they lie in court ?). I really enjoyed the book ! Thanks !

Anastasia was not fluent with English as unlike her elder sisters, she did not have an English nanny but a Russian one ("Shura"). She learned Engllish formally from Gibbes later. Even then she was not a very good student.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 26, 2010, 03:02:08 PM
More on the language issue: Anna Anderson did speak currently German...but not correctly. Did the new book explain why did she speak it faultly? If fact, AA was a German citizen, not a Polish one. Her family was of Polish roots, but they were "technically" German.

I've read in Blair's Lovell book that AA not only can speak Russian but she was also teaching it to her friend Adèle Heydebrand. The people who was researching evidence in her favor even found a notebook in which she was teaching Russian to her friend. I couldn't find any explanation to this issue...Well, i'm not being 100% true about it. The ONLY explanation I've found is that it was Mrs. Heydebrand who was teaching Russian to AA ? Am I right?

RealAsnastasia

P.D: I'll ve in summer vacations for some 10 days since today. So, if I don't answer, don't worry. I will 10 years later!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 26, 2010, 03:06:38 PM
To my mind the unpleasant behaviour and living in squalor came from Anna Anderson's mental illness.

Ann

Maybe. The problem is no one will ever be able to accurately address her mental state in these years from 1968-1978 when things really started to go downhill. Being around the eccentric Jack didn't help AT ALL. But don't forget that there may be something else at work here: she was, after all, a farm girl, poor as things go (not impoverished, though), so the hoarding of possessions, etc., may owe something to those early years when the family did struggle, before Anton inherited his father's farm. You see that kind of behavior today with hoarders, especially people who lived through difficult times early on.

Other peculiarities though-like her passion for animals, cats, and cremating her pets in the fireplace-that all traces back to Kachubian folklore, where they believed in reincarnation into animals and a lot of other odd bits that she began to openly display in her years in Charlottesville.

That's all new for me! So, her closenes to Anthroposofism was related to some practices of Kachoubian folk?

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 26, 2010, 03:07:39 PM
Other thing that always puzzled me is the rage AA showed when Doris Wingender recognized her at Seeon Castle. AA seemed perfectly capable to hide her emotions when something could turn badly for her. She acted as the best of the actress when his own brother, Felix, surfaced and, at first saids: "This is my sister, Franziska". She acted as if she hadn't see him in her whole life! How couldn't she control herself when Doris appeared at Seeon? Did the book cover this issue?

RealAnastasia.

We do. And actually when she came face to face with Felix she did NOT, contrary to what has previously been written, behave as if it was nothing. The Duke of Leuchtenberg's two daughters recalled that when she spotted Felix she "became very agitated, and her jaw trembled through the whole of the meeting." So she wasn't terribly adept at disguising her feelings.

As for her reaction to Doris: this was the same day that the Berliner Nachtausgabe broke the unmasking story, and at the time of the meeting AA had no idea she had been discovered. So suddenly into her rooms comes Doris-right out of a past she was trying to escape, forget, and erase. I think it's easy to imagine what was going on in AA's mind when that happened.



So, she WASN'T a so good actress after all...It's only that the Leuchtenberg's had lied to us...

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 26, 2010, 03:11:09 PM
Quote
I'm not sure AA acted so rude to people fearing she'll be discovered as FS. She was mean toward people who believed her claim and in little things not concerning her identity. She was agressive toward people around little details like the meal was not 100% O.K, or because she had fell in the bathroom, or this or that...These were the details that made me believe for so many time she was AN. An imposter had no reason to be so agressive to people who was kind to her

It was part of the act.  People would think:  "Why is she being mean to those who want to help her?  A real imposter would go out of their way to be nice.  Since she's not doing that, she MUST be Anastasia!"  And it worked, this convinced many people she was AN, not FS.

I don't think FS was so bright than that. She was not a good actress as we may see...If AA was false, I can only conclude that her claim lasted that long only for some people who supported her lied making untrue statesment in her favor...


RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 26, 2010, 03:32:20 PM
It sounds as if many of us are still confused.  But not about the identity of AA but the reasons behind the role she played and the reasons that those who should have known her or recognized her did not. 

I guess it is time to read the book.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on December 26, 2010, 04:52:18 PM
Yes. Not easy for me to buy it, but I think I will. Yes, I must admit I AM confussed. Years and years of believing (and for good reasons, not romantic ones) are not easy to left behind. It's hard for someone who believed a great deal of data as "the real thing" (for example in the books you read "...AA was very calm when felix Schanzkowsky appeared before her eyes..." and now, to finding out it wasn't true) to discover it was scrap...

In this case, almost everybody lied, not only AA. Even Mina Becker, the lady who helped to identify Anne Frank's diary! This is specially hard tpo swallow.

In some ways, I'm not totally convinced. Maybe I accept AA as FS after the reading of the book. It's almost 99% sure. But...I'm doubteous about the causes of all this mess: " Why Harriet Rathlef, Gleb and Tatiana Botkin - both of them had their father killed along with the Romanovs- Jack Manahan ,  the Leuchtenbergs, Xenie Georgievna and the Jennings did what they did? Why did they endorse a totally fake woman as AN? Why Peter Kurth, who is an honest and truthful researcher was convinced about AA bieng AN even againts DNA evidence? I always remember that he knew her personally, and it must have struck him specially. She must have been really special after all...

I didn't know James Blair Lovell, but he seemed to have been really convinced about AA's identity. He even faked some info just to demonstrate it, and there0s people who even said that Penny and Greg didn't made all the research they must, having researched only at Hessian archives. They still believe that AA was AN...

What and odd case...Isn't it?

  RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 26, 2010, 06:42:19 PM
Of course the big thing that helped FS was that the Soviets kept silent on what they did to the family.  They never came out and said:  "The familly is all dead, here are their bodies."  The got rid to the bodies and covered it up, only rumours got out.  There simply was no way to find solid evidence to disprove her claim.

By the time the USSR fell and the thruth started to come out, FS had been dead for seven years.

I don't know why Peter Kurth won't accept the DNA results, DNA does not lie.  It was DNA that finally convinced the late Simon Wiesenthal (sp?) that both Martin Bormann and Joseph Mengle, Nazis he had hunted for decades, were dead.  Maybe that Mr. Kurth was friends with FS has clouded his judgement.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 26, 2010, 09:51:16 PM
RA-I know you haven't read the book yet, but be assured that I think most of your questions will be addressed when you get a chance to do so. I would, though, caution you in assuming now that "everyone" lied, because that's certainly not what we say. Certain people lied, primarily those in the 1920s. Minna Becker, for example, never lied; her work on handwriting was simply wrong-partially because as one of her French comrades explained, the court provided only copies of written samples, which made it impossible for handwriting analysts to conclusively determine things like strength of pressure, the depth of the stroke, etc., that are necessary when rendering an opinion on handwriting for the court. So she was not lying about anything-merely working with bad samples, as the courts all later judged.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 27, 2010, 08:35:41 AM
Of course the big thing that helped FS was that the Soviets kept silent on what they did to the family.  They never came out and said:  "The family is all dead, here are their bodies."  The got rid to the bodies and covered it up, only rumours got out.  There simply was no way to find solid evidence to disprove her claim.

By the time the USSR fell and the truth started to come out, FS had been dead for seven years.

I don't know why Peter Kurth won't accept the DNA results, DNA does not lie.  It was DNA that finally convinced the late Simon Wiesenthal (sp?) that both Martin Bormann and Joseph Mengle, Nazis he had hunted for decades, were dead.  Maybe that Mr. Kurth was friends with FS has clouded his judgement.

Tim, I think you are right.  If the Soviets had simply produced the bodies or the location of the burial, then AA would not have been able to take her sham as far as she did.  I have always wanted to know what motivated her to do this to begin with.  Perhaps that is in the book as well.  Maybe we will finally find out why FS jumped into the canal in Berlin and then came out Anna.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Eric_Lowe on December 27, 2010, 10:26:18 AM
I have read the book but it is still not easy to take. I still have reservations on the actual death of the Romanovs. It is not I do not think they were spared. But the matter of how they try to fit everything nicely into a senario. The part about the bullets flying due to the corsets was first raised by the book "The File on The Tsar", and when the official record did came out it match that perfectly. Edward Radzinsky raise the problems about the execution and the DNA. Do remember when the Romanovs were reburied, The Russian Orthodox Church refused to acknowledge them as the imperial family but only as "Christian Mythors of the Revolution". That was further complicated by the Japanese researcher who matched the DNA with the sweat particle of Grand Duke George (brother of Nicholas II) with Olga Alexandrovna (sister of Nicholas II)'s son, but did not match the official DNA of Nicholas II. The Russian Orthodox Church congradulate the Japanese researcher at once. What is happening here now ? I think AA's DNA has been proven not to be Anastasia, but that does not mean the mystery of what really happened(including the body of Grand Duke Michael) would be revealed.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 27, 2010, 10:36:00 AM
I just ordered the book.  It should be here, according to Amazon, on Thursday 12/30/10.

It sounds a bit more complicated than I originally thought.  I do wonder why no one is ready to say with complete certainty that the bones found belonged to the Romanovs.  It would seem highly unlikely that another group of people with the right number of victims of the right age and sex would have been buried in Pigs Meadow in the summer of the murder.

This is very confusing and so I am looking forward to reading the book this coming New Year's weekend.

Since I don't know what Greg and Penny have said but I have read Kurth and Lovell and Summers/Mangold, I am looking forward to this new perspective.

Why should the murder of one family be so hard to come to terms with?  Why should the evidence be so hard to find and to prove to be true?
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Eric_Lowe on December 27, 2010, 10:44:32 AM
The book just deals with AA saga. It starts from Anastasia to Anna Anderson to Franciska. It did cast more doubts on her supposed memory and physical similarities with the grand duchess. It did demolish her case and let people (who supported AA) to think there is a strong argument for her to be Franciska. The book is very well researched and written but it did not answer every question. Apart from the ones I raised on what I have posted. The fact that Anna Anderson was quite convinced of the trip "Uncle Ernie" took during the war was not discussed in detail. The fact that Victoria Luise of Brunswick heard it being discussed and Crown Princess Cecilie confirmed it being taken place with others on the Russian side made it possible and believable. I did not buy King's stance that it was "gossip". That is an important element in that that cannot be glossed over.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on December 27, 2010, 12:54:08 PM
RealAnastasia

I came to Anna Anderson from the opposite direction, having begun as a sceptic and remained so. The whole story of her 'escape' seemed so inherently improbable.  What interests me now is how someone who, to my eyes, didn't look at all like Anastasia, managed to convince so many people for so long. That is why I am looking forward to reading the book.

Ann

The story of her "escape" was not so improbable for me. Argentina is a country of European immigration, and a lot of people who settled here, having suffered WWI and WWII escaped more miraculously than the story AA told to her supporters. I knew an old man (now dead) that had received a bullet in his head and had been lying under several corpses for some two hours. The murders (in this case, Russian soldiers at WWII), believed they had killed him. He waited until they went away, and then almost dead but not dead, reached a  house, where he was helped. The bullet had not entered in his brain, but only to the surface tissue.  He was cured by a doctor. he had the face almost all smashed a had some bullets in other parts of her body. He was hidden and healed, and then, his brother and him went half walking, half in charriot trying to reach France's borderline, what they did. They lived poorly and after a while, they took a ship and settled in Buenos Aries.

No; AA's "story" COULD have happened. But is just that it never happened.All that she stated could have been the way she did; it just WASN'T.

RealAnastasia,.

I think these post are VERY important to remember in future discussions.   AA's story could have happened, it's just that it never happened to FS.  

I won't spoil this explanation which King and Wilson gave in their book.  But the answer is there for you to read.

The other reason I mention it,  is because time after time I provided information proving that AA's story of her trip from Ekaterinburg to Budapest had
been possible, because others had survived by escaping by this same route, and, AA may have been merely repeating true stories she had heard.  

Now,  I'll go finish this new book of King and Wilsons.   I do have a few questions, well, maybe more than a few about  AA being FS....   Surprise.  Surprise.  Surprise.  But I'll wait until most of you have had a chance to read their book.

AGRBear
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 27, 2010, 10:05:27 PM
We don't conclude anything other than that the Romanovs were killed in the Ipatiev House. Aside from going in briefly to the identification of the 2007 Koptyaki remains (and speaking personally, here no one will ever convince me that it was not Anastasia whose remains were found then given the uniform opinions of the disparate American forensic teams who examined and opined on the original Koptyaki remains) we simply report what is true-they have all been found. We interviewed Michael Coble about the whole "conspiracy" scenario for this as well as with the AA DNA tests, and you can find his comment on this in the epilogue.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 28, 2010, 01:32:35 AM
Quote
and speaking personally, here no one will ever convince me that it was not Anastasia whose remains were found then given the uniform opinions of the disparate American forensic teams who examined and opined on the original Koptyaki remains

Me neither.  Anastasia died with her family that terrible day in 1918.   DNA proved that.  Case closed.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 28, 2010, 10:04:59 AM
The only problem that ever had with the Koptyaki findings was that at first only 9 of the 11 were found.  That in itself is not the problem.  The others were just buried elsewhere.  The problem that I found was that at first, the identification of the missing was in doubt.  Then as Anastasia "escapee supporters" began to question the identity of the woman who was not in the original grave and many thought that it was Anastasia not Maria who was missing - suddenly small amounts of bone and teeth were found and with almost nothing to work with the "remains" were said to be that of Marie and Alexei.  That put Anastasia in the original grave with the others.

I repeat that I have always wanted to believe that all of the family escaped.  I never wanted to think of the horror that took place in the basement of Ipatiev House and hoped that it was a myth.  I also never believed that Anna Anderson was Anastasia Nikolaevna and I gave my reasons in prior posts.

However, it just seemed too convenient that authorities found those dusty charred remains and then declared them to be Maria and Alexei so quickly.  Then those very important remains were put aside and stored in a "back room" somewhere never to be heard of or talked about again.  

I know that the Russian Orthodox Church has not actually recognized any of the remains found in the original grave and especially not in the second grave conclusively and I don't know why  it hasn't but I also don't know if it matters of not.

I hope that reading this book helps me to understand more than I do now.  I wonder if the "gossip" or whatever it was about Ernst Ludwig visiting his sister Empress Alexandra during the war matters or not either.  I don't know if Anna Anderson possibly knowing about the visit matters or not either in helping to prove or disprove any theories.  Everything seems so convoluted.

In the end the DNA testing of Anna Anderson's tissue against that of Franciska's relatives showed a great certainty that Anna Anderson was not Anastasia Nikolaevna but was in reality Franciska Schanzkowska.  I know that experts say that DNA doesn't lie, but it always seems to me that DNA testing gets its results through the "back door".  It tells what isn't - not what is.  And even then, does it show conclusively what isn't true or does it only show a "high probability" of what isn't true?  

It is like saying that the results show that Anna Anderson "could" have been Franciska and so she "might" not have been Anastasia.  It never says "definitely".

I hope that I haven't spent good money on a book that won't help me to understand anything more that I already do.  But I know that Greg and Penny have done an enormous amount of research and that alone should make the book worth reading.  If only to find something new to debate about.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on December 28, 2010, 11:09:18 AM
The only problem that ever had with the Koptyaki findings was that at first only 9 of the 11 were found.  That in itself is not the problem.  The others were just buried elsewhere.  The problem that I found was that at first, the identification of the missing was in doubt.  Then as Anastasia "escapee supporters" began to question the identity of the woman who was not in the original grave and many thought that it was Anastasia not Maria who was missing - suddenly small amounts of bone and teeth were found and with almost nothing to work with the "remains" were said to be that of Marie and Alexei.  That put Anastasia in the original grave with the others.

I repeat that I have always wanted to believe that all of the family escaped.  I never wanted to think of the horror that took place in the basement of Ipatiev House and hoped that it was a myth.  I also never believed that Anna Anderson was Anastasia Nikolaevna and I gave my reasons in prior posts.

However, it just seemed too convenient that authorities found those dusty charred remains and then declared them to be Maria and Alexei so quickly.  Then those very important remains were put aside and stored in a "back room" somewhere never to be heard of or talked about again.  

I know that the Russian Orthodox Church has not actually recognized any of the remains found in the original grave and especially not in the second grave conclusively and I don't know why  it hasn't but I also don't know if it matters of not.

I hope that reading this book helps me to understand more than I do now.  I wonder if the "gossip" or whatever it was about Ernst Ludwig visiting his sister Empress Alexandra during the war matters or not either.  I don't know if Anna Anderson possibly knowing about the visit matters or not either in helping to prove or disprove any theories.  Everything seems so convoluted.

In the end the DNA testing of Anna Anderson's tissue against that of Franciska's relatives showed a great certainty that Anna Anderson was not Anastasia Nikolaevna but was in reality Franciska Schanzkowska.  I know that experts say that DNA doesn't lie, but it always seems to me that DNA testing gets its results through the "back door".  It tells what isn't - not what is.  And even then, does it show conclusively what isn't true or does it only show a "high probability" of what isn't true?  

It is like saying that the results show that Anna Anderson "could" have been Franciska and so she "might" not have been Anastasia.  It never says "definitely".

I hope that I haven't spent good money on a book that won't help me to understand anything more that I already do.  But I know that Greg and Penny have done an enormous amount of research and that alone should make the book worth reading.  If only to find something new to debate about.

1. Bob Atchison saw and held he remains of the original 9 in Ekaterinburg not long after they were unearthed. As a trained portrait painter (he studied under Chuck Close, actually) Bob has an eye trained for facial shapes and recognition.  As a Romanov scholar, he is intimately familiar with the faces of the IF.  He told me the moment he got home from the trip that he was 100% certain the skull was Anastasia and not Maria.  Now make of that what you will, however in the end, the question is moot. All were accounted for.

Alixz, the DNA science is indeed 100% certain. The "doubt" is infinitesimal, in the case at hand, the "probability" that the DNA found is NOT the Imperial Family is on the order of 10 billion to 1. Science is so precise that they feel "bound" to include the hugely impossible alternative.  The certainty level that AA was NOT ANR is 1 in a trillion.  There is 100% certainty that AA was separated from a common maternal ancestor by at LEAST 25 generations as revealed by the Five mis-matched mDNA loci.  ONE mis-match is a genetic mutation that occurs only once in 20 generations.  This is the problem with the AA=FS match, it can only say that AA and FS were related within the last five generations because there was no mDNA mis-match.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on December 28, 2010, 11:59:45 AM
'This is the problem with the AA=FS match, it can only say that AA and FS were related within the last five generations because there was no mDNA mis-match.'

So what we have is certainty that Anna Anderson was not Anastasia, but a degree of doubt that she was FS?

I also have a degree of doubt that the remains in the second grave are Anastasia rather than Marie, though, to be perfectly honest, I did not want it to be Anastasia that was unaccounted for (my initial reaction, 'Oh no, it WOULD be Anastasia!'). However, they all now accounted for, and all died at the Ipatiev House.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on December 28, 2010, 12:23:45 PM
Well, yes and no. While there is "some" degree of doubt that AA was FS directly, WHAT are the odds that AA was so very closely related to FS? Certainly far far far more than picking some random Eastern European woman...

Greg and Penny's book simply brings those odds to such a high level that the rational person must conclude they are one and the same person.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 28, 2010, 01:40:43 PM
FA thank you for the information.  I know that Bob is quite knowledgeable and his information means a great deal.

Kalafrana - I too thought as you did when the initial finding came out.  The two most talked about "survivors" were always Anastasia and Alexei and at first, it seemed as if they were still missing.  I truly have no doubt as to who was in the larger grave.  9 people were found and the make up of the group made it clear that it was the Imperial Family and their retainers.

I just still have problems with how hurried everything was with the second grave site.  Almost as if there had to be two more found just to put the survivor theories to rest.  I just can't help it.  The remains were so small and so degraded and burned and powered, it just still makes me wonder.  It felt contrived to put the "survivor" theories to rest.

But that does not mean that I think that Anna Anderson was Anastasia.  I have said before, that I could never come to terms with Anna Anderson and the way she lived and treated people.  I still feel that if she were the real Anastasia, she would have just told Grand Duchess Olga Alexandrovna something that only the two of them would have known and be done with it.

I do believe that Anna Anderson was Franciska, but I still would like to know when and why she decided to take on the identity of a dead girl and what her motives were.  It certainly wasn't greed or the idea of living the good life because she didn't.  Why did she jump into the canal?

The only reason I can come up with is mental disease.  Some kind of mental disorder that was not yet recognized by doctors.

Are these the kind of questions that the book answers?
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on December 28, 2010, 01:57:27 PM
It is truly unfortunate that W.R Maples didn't live long enough to compare the bones of  remains listed as "Body No. 5" with those found in the last two graves found in July of 2007.  This is what Maples  wrote:  "Half of her middle face was missing, a pattern of damage already seen in Body No. 3.  Dr. Levine and I agree that she was the youngest of the five women whose skeletons lay before us.  We concluded this from the fact that the root tips of her third molars were incomplete.  Her sacrum, in the back of her pelvis, was not completely developed.  Her limb bones showed that growth had only recently ended.  Her back showed evidence of immaturity, but it was nevertheless the back of a woman at least eighteen years old.  We estimated her height at 67.5 inches [that's a little more than 5 feet 6 inches].  The Russians told us that a bullet had been found in a lump of adipocere near the body.  We believe this skeleton is that of Marie, who was nineteen years old at the time of the murder."



Maples had a lot more bones to view than the fragments of bones found in the two graves in July of 2007.

Kings and Wilson's latest book deals with AA/FS and this is what he has just told us.

We don't conclude anything other than that the Romanovs were killed in the Ipatiev House. Aside from going in briefly to the identification of the 2007 Koptyaki remains (and speaking personally, here no one will ever convince me that it was not Anastasia whose remains were found then given the uniform opinions of the disparate American forensic teams who examined and opined on the original Koptyaki remains) we simply report what is true-they have all been found. We interviewed Michael Coble about the whole "conspiracy" scenario for this as well as with the AA DNA tests, and you can find his comment on this in the epilogue.

Bear's  position still finds  Maple's findings worth more weight  than the Russians who view the same remains as being Marie, who was about 5 feet 6 inches, and not Anastasia,  whom most believe never grew taller than 5 feet 2 inches.

I just finished RESURRECTION OF THE ROMANOVS and found it worth every penny.  (No pun intended.)  This is a book about   AA / FS.  Do not buy it if you are doing so to discover evidence about the subjects such as the one about  which  Grand Duchess is buried in which grave  (mass grave found earlier or the latest two graves of 2007).

AGRBear

 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 28, 2010, 02:03:38 PM
Bear, I am confused by your quotes.

Did Maples think that the bones were Anastasia or Marie?

Did the Russians think that the bones were Anastasia or Marie?

Who thought what?  I have read that quote three times and I still can't figure it out.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on December 28, 2010, 02:28:17 PM
The Americans believed the remains found in the first grave site were Maria.  The Russians and Bob believed it was Anastasia who was found and Maria was the missing one (finally discovered in 2007)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on December 28, 2010, 02:40:59 PM
'We estimated her height at 67.5 inches [that's a little more than 5 feet 6 inches].'

Actually it's 5ft 7 1/2.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on December 28, 2010, 03:08:41 PM
Bear, I am confused by your quotes.

Did Maples think that the bones were Anastasia or Marie?

Did the Russians think that the bones were Anastasia or Marie?

Who thought what?  I have read that quote three times and I still can't figure it out.

Sorry for the confusion.

Maples believed Body No. 5 found in the mass grave was GD Marie.  The Russians believe Body No. 5 was Anastasia.

 I'll quote from his book DEAD MEN DO TELL TALES which gives us why his conclusion is important:

>>Until his death in February 1997, Dr. Williams R. Maples was a distinguished service professor and curator-in-charge of the C.A. Pound Human Identification Laboratory at the Florida Museum of Natural History in Gainesville.  He was president of the American Board of Forensic Anthropology and a fellow of the American Academy of Forensic Sciences.<<

AGRBear
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on December 28, 2010, 03:31:33 PM
[quote{Greg King}]and speaking personally, here no one will ever convince me that it was not Anastasia whose remains were found then given the uniform opinions of the disparate American forensic teams who examined and opined on the original Koptyaki remains

Me neither.  Anastasia died with her family that terrible day in 1918.   DNA proved that.  Case closed.
[/quote]
 
Greg's point is a contention that Anastasia's body was missing from the original grave.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on December 28, 2010, 03:33:21 PM
Just a reminder to our Forum Members: this thread is about Greg and Penny's book. It's not about FS/AA and I find that some of the posts are discussing that and not the book. I will review the posts and delete which violate Forum policy after taking some time to digest all of this. BTW, violations of our policy would be in some cases, doubting the DNA tests.

Also as a matter of clarification, our friend Peter Kurth has in numerous emails to me said he accepted that AA was not ANR, so I wish people would stop saying that he does not. It's tiresome to have to keep re-quoting myself! Peter did not believe that AA was FS. I don't know what he thinks now that Resurrection has come out.

As to "does the book cover x" questions: I know that some of our members cannot purchase the book but please go to your library and if you cannot buy it and request it from Interlibrary loan if necessary. I don't think it's fair to our members who are writers to have to reveal all of their research this way.

Suffice to say, King and Wilson fully explain to at least my satisfaction who Franziska was and how she was able to impersonate the Grand Duchess for most of her life. It's a fascinating story, so I would urge you to read it if you can.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on December 28, 2010, 03:38:55 PM
The Americans believed the remains found in the first grave site were Maria.  The Russians and Bob believed it was Anastasia who was found and Maria was the missing one (finally discovered in 2007)

At least one Russian scientist (Filipchuk, I think) presented data which also suggested that the youngest girl was the one missing. I don't think it can or should be reduced to a matter of nationality, because when it is people begin to raise accusation of particular emotional bias (e.g. Russians "wanting" AN dead, or Americans "influenced by Hollywood" etc into hoping she survived) over what is or was a matter of scientific dispute. Maples - for example - was 100% clear on believing that AN was dead - regardless of his firm belief that her body was missing.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 28, 2010, 04:26:39 PM
Well, it really doesn't matter which girl was in the second grave, the DNA tests proved she is related to the others found in 1991.  Therefore, all the Romanov's have been accounted for.    They all died in 1918.

AA, whoever she was, was not Anastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 28, 2010, 09:19:17 PM
Mindful of Rob's point about NOT steering the conversation too broadly away-I would merely say that if you think it's convenient that they actually found the missing remains, and that this was somehow orchestrated, would they not have done so sooner than 2007? Too much time passed between the exhumation of the mass grave and the discovery of these sets of fragmented remains to make any conspiratorial linkage likely in my opinion.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on December 29, 2010, 04:33:52 AM
Well, it really doesn't matter which girl was in the second grave, the DNA tests proved she is related to the others found in 1991.  Therefore, all the Romanov's have been accounted for.    They all died in 1918.

AA, whoever she was, was not Anastasia.

AA was Franziska, and I would have thought that the identity of the remains in each grave DID matter to those who revere the memory of the Grand Duchesses - for the sake of giving someone the dignity of the correct name?

This is sort of off-topic, I fear, as the thread seems to have veered towards speculation rather than discussion of the book, because a number of people here are commenting without having read it.
I think I will bow out of this thread....

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 29, 2010, 09:30:10 AM
Accept my apologies.  I did say that I could not comment on the book because I hadn't read it.

I also have said again and again that I never believed that Anna Anderson was Anastasia Nikolaevna.

I have asked too many questions which should only be resolved by reading the book and so I will stop that.  My copy should be here in the next couple of days.

About the validity of the DNA testing.  I guess that I just don't know how it works no matter how many people explain it to me.  Sorry about that.  It just does (to me anyway) always seem to point out what is not instead of what is.

Quote of Greg King:

Mindful of Rob's point about NOT steering the conversation too broadly away-I would merely say that if you think it's convenient that they actually found the missing remains, and that this was somehow orchestrated, would they not have done so sooner than 2007? Too much time passed between the exhumation of the mass grave and the discovery of these sets of fragmented remains to make any conspiratorial linkage likely in my opinion.

Perhaps it just seemed a short time to me.  When Dr. Maples thought that the missing remains were Anastasia and the Russians didn't it sparked another round of "survivor" mania.  The last thing IMHO that the Russians needed was more Anastasia survivor theories.  It appeared in the interest of closing the case and putting Anastasia survivor stories to rest to find the other remains and then "prove" that the girl in the second grave was Maria.  I know that the original remains were discovered in 1991. The information was released in 1993. But 1993 to 2007 is a long time.

Please, Lisa - don't remove posts just because they might seem to violate forum posting rules.  That leaves a thread with holes that no one who comes along to read at a later date can understand.

Just censure those of us who have violated forum ethics as the US House of Representatives recently censured Congressman Rangel.  We will take our punishment with grace.

I will shut up now.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on December 29, 2010, 10:15:33 AM
Some points of clarification: I did not remove any posts when I saw the discussion veering off topic for a couple of reasons. First, I think people get excited by the whole AA/FS topic area, a fact that the numerous posts about her will attest. So, I tend to not be too harsh with those who are enthusiastically discussing her, even if it veers OT. I get it. I also get that trimming and removing posts is itself annoying not to mention, disruptive to the thread itself. Because I get all of this, I am a good choice for "sheriff" of "Shanzkowskaville".

But, any posts that question whether or not AA/FS was ANR after this will be removed, and those who said this do not include our beloved Alixz. The reason? It violates Forum policy. I will also admonish those who are not being fair to our writers. It's very generous of Greg to post here and answer questions, but I do not expect him to do so if not treated fairly. And, I think it's in the Forum's best interests to have writers welcomed here to answer reader questions. If you disagree with this policy, feel free to PM me, I am open to input. I am being more proactive about this after being published myself this year - and because I felt kind of broadsided by some of the comments.

The first grave was discovered in the late 1970's by Avdonin and Ryabov. They revisited several times but the discovery was announced by Ryabov in the late 1980's (I think 1987?) by Ryabov alone much to Avdonin's surprise. The main grave was excavated in 1991, with those remains entombed in 1998. The second grave was finally found in 2007, the culmination of years of searching by many people. Was it convenient? I think not! But, that's another story all together.  The thing is, while the burials were a secret, those Bolsheviks who participated were essentially truthful so with various statements, it was ultimately possible with the statements to find the two graves.

And I hope Janet continues to post on this thread!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 29, 2010, 11:26:48 AM
I hope that Janet continues to post as well.

Again, I am sorry if I caused any dissension.  I never meant to.  But, as Lisa said, it is very hard not to get carried away.

I am not sure, since I never believed that AA was ANR how I even got started on the subject of DNA etc.  I only said that, in the past, I wanted to believe that someone survived, but since 1993, I have known that they did not. 

As someone else said, they were all killed in July of 1918.  It truly doesn't matter who was in which grave.  They were all there.

Back to topic.  It should be interesting to find out how Franciska managed to live a lie for most of her life and to have others believe her when she was the most disagreeable claimant of the bunch.  Perhaps it was just that those who survived felt guilty about surviving (I think that psychiatrists have a word for that) and played along to salve their own consciences.  Even though the survival of one person from the family never had anything to do with the survival of another, some would have felt guilty enough to want to believe.



Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 29, 2010, 12:58:51 PM
Amazon is quite fast.  The book just arrived.

I just read the acknowledgements and I am very impressed with all of those who helped with the research and the writing.

Many members of the Forum are listed.  Some I expected to see and some I was surprised by.

It would seem that we are in stellar company on this forum.

Congratulations to Greg and Penny and to all.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 30, 2010, 09:12:41 AM
I guess I was lucky.  I ordered it from Amazon.com on Monday the 27th and it was delivered yesterday the 29th.  I didn't even pay for next day shipping (I never do).  When I said it was quite fast, I meant quite fast!

I read through Part One "Anastasia" last night.  That is about 75 pages.  Next is "Anna Anderson" or Part Two.

So far, nothing new about Anastasia that I hadn't already read but then her life has been covered before.  Interesting tidbits about her weight and her lack of interest in schooling.  Like most kids, she wanted to learn until she had to do it every day.  There is a letter written by her in English with numerous spelling errors (English is a hard language to write as so many words sound similar but are spelled quite differently)  and grammar errors.  I don't know how well she spoke English, but she wrote it terribly.  I would think that would have an impact on the claims of Anna Anderson and those who supported her. 

But Part Two awaits...
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Dust_of_History on December 30, 2010, 09:56:44 AM
Yes, I have a picture of one of her texts in her exercise book. It's an English text which contains numerous spelling errors which were corrected by Mr. Gibbes. I have to say I'm a bit confused that her English skills were so bad, because I read that she was good at speaking French. IMO French is even more difficult than English.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Eric_Lowe on December 30, 2010, 10:15:13 AM
I think her English suffered because Anastasia did not have a British nanny unlike her parents and elder sisters...
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 30, 2010, 10:31:37 AM
My French is bad, but I read it better than speak it because of all of the "dropped" letters at the end of words in French and all of the er's that are said as a's.  Ex:  croupier pronounced croupia. (long a not short a)

English is tough to write and read.  I just used a great example:  read and read.  Read can be reed or read can be red.  I can read (reed) the book.  I read (red) the book yesterday.  But read (red) and red (the color) are not the same word either.  And read and reed are also not the same word.  They just sound alike.

I read the book yesterday and the cover was red.  I want to read a book about reeds.

Also look at the word tough.  It is pronounced tuff.  You have to live with a language to get used to all of the strange things that alphabet letters can do.

I think that applies to any language, but the ones that Anastasia had to learn were very hard.  English, French, German which use the Arabic alphabet and then Russian with its Cyrillic alphabet.

A facility with languages is not something that everyone enjoys.  I love English, although I hated learning it in school.  But now I see the complex variations and the subtleties and I like to work with them.

But finally:    THANK GOD FOR SPELL CHECK!  I wish all computers programs had grammar check as well.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 30, 2010, 10:36:45 AM
Eric - did you notice that I had to go back and change the end of my last sentence?

Grammar check are well had to be changed to grammar check as well.  I need that grammar check and I need it NOW!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on December 30, 2010, 01:14:32 PM
Re Post #123:    Hello, Alixz!   "Arabic" alphabet (re  English, French, German...) ?  I'm certain that you meant the "Latin" alphabet !  In good humor, and with best wishes for the New Year!   AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Robert_Hall on December 30, 2010, 01:37:17 PM
I was wondering about that myself. I know the Arabic alphabet and could not see any connection to German
 However, the topic of this thread is the book. I have almost finished it and find it well worthwhile for anyone interested in the subject.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Sarushka on December 30, 2010, 03:22:04 PM
Yes, I have a picture of one of her texts in her exercise book. It's an English text which contains numerous spelling errors which were corrected by Mr. Gibbes. I have to say I'm a bit confused that her English skills were so bad, because I read that she was good at speaking French.

I don't think it's an unusual phenomenon. Plenty of smart people who speak fluently communicate poorly in writing, even in their native language. I remember proofreading a paper for a friend in college -- a girl who'd graduated among the top 10 of our high school class -- and was stunned by how terribly awkward the grammar was.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Dust_of_History on December 30, 2010, 04:18:10 PM
Do you mean dyslexia? Did Anastasia suffer from it?

As far as I can recognise, she made typical non-native speaker spelling mistakes. For example she wrote:

thay (they)
pritty (pretty)
pat (put)

She also often used the word "will" where it should be "would". And she confused the word "now" with "know". :-)

But Mr. Hall ist right, this is terribly off-topic.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Sarushka on December 30, 2010, 05:47:20 PM
Do you mean dyslexia? Did Anastasia suffer from it?

No, not at all. I just think she wasn't proficient in written communication. And she was a lazy scholar to boot.

In a nutshell, I don't think we can infer much about her oral English skills from a written school assignment.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on December 30, 2010, 06:32:33 PM
Bringing us back to RESURRECTION.  I found the section on FS very interesting.
It is said that she was a very good student.  Otto Meyer, the son of the teacher who was quoted in saying FS was limited
in intelligence, thought otherwise:
p. 272
>>...always did very good in school.  She spoke well, and learned everything she scould.  She often received recognition for her performance from the School Rector.<<   Others students and her sister agreed with Otto Meyer.  Proof: >...she completed her ninth grade studies in fewer than six months winning a certificate of graduation far ahead of her classmates<<

They don't mention anything about FS's spelling.
-----
A side note on spelling.  No one can judge a person's intelligence by their spelling.  I know many   smart doctors, lawyers and CEOs who spell worst than GD Anastasia.   Added to this list are authors, who are well noted for their terrible spelling.   If it hadn't been for Sophia,  her husband, Leo Tolstoy,  may never have been published.

AGRBear
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on December 31, 2010, 04:46:06 AM
Anastasia was a very lazy student and her education wasn't taken very seriously. Result, little progress.

Having now read the book I can recommend it very strongly. I would say that Anna Anderson had a good brain, though limited formal education, and, in particular, an extremely retentive memory, especially for small details - this was one of the key factors in deceiving the people she did deceive. She also had a remarkable capacity for making people for sorry for her, and providing her with accommodation for lengthy periods - very much on her own terms and despite her awful behaviour.

I will also say that I am now entirely satisfied that the identification as Franciska Schankowska is correct (I had a slight margin of doubt previously), but I will probably carry on calling her Anna Anderson because it is so much easier to pronounce.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on December 31, 2010, 06:04:17 AM

I will also say that I am now entirely satisfied that the identification as Franciska Schankowska is correct (I had a slight margin of doubt previously), but I will probably carry on calling her Anna Anderson because it is so much easier to pronounce.

Ann

If it makes you feel any better, both Penny and myself sort of regard her as separate entities as well-until 1920 she was Franziska, after this Anna Anderson; though one and the same, in some ways-even thoroughly, absolutely knowing she was the same person before and after 1920, it's difficult to reconcile the one with the other-not in terms of evidence or questions of identity, but merely as individuals. One is ordinary, shadowy, all but lost to history; the other is a legend in her own right.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 31, 2010, 11:32:11 AM
Of course, one can look at the picture of FS and the young AA, they look very much alike.   Clearly they are the same person.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on December 31, 2010, 12:17:35 PM
Re Post #123:    Hello, Alixz!   "Arabic" alphabet (re  English, French, German...) ?  I'm certain that you meant the "Latin" alphabet !  In good humor, and with best wishes for the New Year!   AP.

Of course you are right.  I was thinking Arabic numerals.  After I posted, I meant to come back and change that, but thank you for doing it for me!   ;-)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on December 31, 2010, 04:23:07 PM
I just heard from Chapter's.  My copy has arrived.  I'll have it on Tuesday.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Georgiy on January 01, 2011, 12:51:20 AM
According to Amazon mine's not due till Jan 31. :-(  Still, it might get here quicker. Am very much looking forward to read about this person who fooled so many for so long.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 01, 2011, 04:18:54 AM
Sorry it seems to be taking so long for some orders but hopefully it will be worth the wait!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Geniebeanie on January 02, 2011, 10:15:20 PM
I bought it from Amazon and found it very interesting.      Sorry but I still think she was the Grand Duchess, Only one tenth of DNA is different from a indivual and I still think the test  were conducted to prove she was not  the GD.   Nothing will ever change my mind.  Still the book was interesting.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 02, 2011, 11:29:50 PM
As I have said over the years, even incontrovertible empirical evidence will not convince die-hard AA supporters. I do suggest that the previous poster educate herself about DNA testing and be aware of our Forum policies.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 02, 2011, 11:45:58 PM
Lisa, there are people out there who still believe the Earth is flat.  No matter how much evidence you show them, they won't believe.  The AA supporters are the same way, it seems.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Carisbrooke on January 03, 2011, 07:03:18 AM
   Over the years I've gone through the whole list of emotions regarding AA's claim. From yes it could be the Grand Duchess to no it certainly isn't, & then latterly to a downright hatred of the woman. After reading G & P's book about all her misfortunes, especially from her early family life and then under the care of Doris Wingender, I could only feel sorry for her. As for arguments over DNA in this case its all irrelevant, the myth is busted, FS was AA and therefore not Anastasia. I think the book makes that clear, no science is required at all. AA's claim always was a matter of personal belief, so it seems ironic that in the form of the DNA we had to rely on something most of us don't understand or trust. Thanks to this book, it means we do not have to do so anymore.
                
     Yet again another herculean task from the Greg & Penny team. I add my congratulations to the ever growing list.          
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 03, 2011, 09:53:55 AM
Indeed it is an excellent book and I too, have compassion for Franziska for her suffering. However, I am incensed about what she put the real grand duchess' family and friends through. That was truly despicable. Yes, regardless of the facts and proofs, there are those who believe Anastasia survived, the earth is flat, and that you can get something for nothing.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 03, 2011, 10:09:42 AM
Understanding DNA is very hard for a lot of us.  I have not yet begun to understand exactly how the process works, and yet I have had it explained to me by many Forum members who are scientists and medical experts and I still don't get it.

So, I have to accept what I am told.  However (and again, I don't believe that Anna Anderson was Anastasia Nikolaevna) I am still and always be confused by the DNA process and how it proves anything.

I do think though that continuing to talk about "flat earth" believers is a little condescending.  Perhaps we should stick to the book and discuss its merits or flaws.

I have not yet finished reading it.  I started with a lot of time over New Year's weekend, but several family concerns and a bad head cold took some of that time away from me.  I plan to get back to it today. 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 03, 2011, 11:20:03 AM
Understanding the DNA is important. It really is not "mysterious" or in fact unreliable whatsoever. So, allow me to try to do this simply (even if a little OT, but heck I'm the FA so indulge me):

There are 2 kinds of DNA.  nDNA, or nuclear DNA, which comes from the nucleus of every cell in your body. The original AA test was done with mtDNA, or mitochondrial DNA.  Every person has little bubble of mtDNA in every cell in their body OUTSIDE of the nucleus. mtDNA only comes from the mother, fathers can't pass it along. nDNA changes with every person born.  Mom and Dad each contribute some of their own nDNA to the baby. Some strings of nDNA don't change at all and are the same as the parent that provided it. which is why we can test nDNA for sibling relationships or parental relationships or even Family relationships...Now, mtDNA on the other hand, is very very stable. It only changes, or "mutates" one time in every five generations!! That means, for example, Alixz's mtDNA is the EXACT SAME without variation, as her mother, grandmother, great grandmother, great great grandmother and great great great grandmother!!

That is why mtDNA science can't say for certain WHICH person of those five provided the sample.  BUT, lets us say, Alixz gets an email from someone who says they are her long lost cousin "Zelda" on her mother's side. So, to prove that with mtDNA science we take a sample from Alixz, and a sample from Zelda.

First we look at Zelda's mtDNA. We would see a long string of letters ACTG  in different combinations.  Lets say for example that Zelda looks like this at one point on the strand: ACTGAATGCCAGGTACGAGCT.  We know for certain that Zelda's maternal ancestors for five generations all have the same sequence.

Now we look at the SAME STRAND from Alixz. Her sequence is this: ACTAAACGCCTGGTACGAGCT

Now, we know that for one thing, Zelda's mtDNA can't have been intentionally manipulated in testing. Why? Because it was done FIRST. We had no idea what Alixz's sequence would look like!! We hadn't learned that code yet.

We also know one other thing for certain. Zelda and Alixz aren't related for at least FIFTEEN GENERATIONS! Why?? because mtDNA only makes one change, one different letter, in FIVE generations. Here Zelda has THREE different letters. Three changes means at LEAST Fifteen generations of women before we find a common mother.

Now, what really happened was that AA's mtDNA was sequenced first. We know it can not have been manipulated because ANR's sequence was not yet known.  There were FIVE different letters, or five "mis-matches" between AA and ANR. Just ONE means AA can not have been ANR, but they found FIVE!! No matter how many other pieces of the mtDNA strand they test, those FIVE will always be there.

This explains why we know for certain AA can't have been ANR, but also why we can't say for certain that AA was FS, using mtDNA. 

Is this any clearer? Questions??


 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 03, 2011, 11:47:17 AM
One point and one question.

mtDNA testing only works with people related EXCLUSIVELY through the female line (whether or not they are female themselves). So the researchers were able to use a blood sample from the Duke of Edinburgh, whose maternal grandmother was Alexandra's sister, to do comparisons with Alexandra herself and her daughters, but the Duke's own children get their mtDNA from the Queen, and back from her through the Queen Mother's female line. As I understand it, finding a suitable person to be a match with Nicholas was more problematical, but the researchers eventually used his brother Georgi Alexandrovich, and the Duke of Fife, who is a female line descendant of Marie Feodorovna's sister Queen Alexandra. Did the researchers use Tikhon Koulikovsky in the end? I understand he was initially very reluctant to be involved.

Now the question. Are the changes every five generations a regular thing, or is this an average? Not that this being an average would invalidate the results.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 03, 2011, 11:55:58 AM
The five generations is not an average, it is the actually the fastest it mutates. It might not mutate for 8 or 10 generations, it seems to have never mutated more frequently than five, so they use five as the fastest mutation calculation.  I don't know if Kulikovsky was used or not.

Nicholas II was not identified exactly with mtDNA. He was matched with nuclear DNA from his brother George., and most recently with the Otsu blood stain. They all matched exactly, even down to a rare mutation in one gene. His initial ID was done with Fife. and mtDNA, I believe.

The other point is that all males carry the same mtDNA as their mothers, so male descent can be used as well, which is how FS's nephew provided the mtDNA sample that showed the likelihood of the AA match to FS.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Eric_Lowe on January 03, 2011, 12:00:24 PM
Well...That is still the Japanese finding that the bones in the mine is not Nicholas II, by using the sweat particules of his long dead brother Grand Duke George and the son of his sister Grand Duchess Olga Alexandrovna. That IS an important finding that Greg King "brushed aside" in his book "The Fate Of The Romanovs" but that finding is DNA based too. You cannot have favour one DNA finding when another DNA finding tells you another. I do not want to comment here, but it seems people here accept that DNA is 100% infallable !  hense I decided to throw this in. If the bones in the mine is not Nicholas II then AA is not FF too. Also do remember that Japanese team had the applause of the Russian Othodox Church who decided to bury the bones as "Christian Saints of the Revolution" rather than as the Imperial Family.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on January 03, 2011, 12:46:45 PM
Well...That is still the Japanese finding that the bones in the mine is not Nicholas II, by using the sweat particules of his long dead brother Grand Duke George and the son of his sister Grand Duchess Olga Alexandrovna. That IS an important finding that Greg King "brushed aside" in his book "The Fate Of The Romanovs" but that finding is DNA based too. You cannot have favour one DNA finding when another DNA finding tells you another. I do not want to comment here, but it seems people here accept that DNA is 100% infallable !  hense I decided to throw this in. If the bones in the mine is not Nicholas II then AA is not FF too. Also do remember that Japanese team had the applause of the Russian Othodox Church who decided to bury the bones as "Christian Saints of the Revolution" rather than as the Imperial Family.


You are incorrect - FOTR did not "brush aside" anything. On pages 444-5 it devotes a lot of space to the objections raised in the Nagai tests before concluding that the weight of DNA PLUS historical PLUS anthropological evidence suggests that that bones are those of the Romanovs. You obviously prefer to "brush aside" the anthropological and historical evidence, as well as the rest of the DNA evidence that contradicts Nagai (there's rather more than just one set), whilst insulting those who understand the science for their credulity, and that is your prerogative, but please don't expect your logic to remain unchallenged.

Apparently (and this IS on-topic for the thread) you misunderstand the arguments relating to Ernst Ludwig's purported trip to Russia as well. THe issue of whether it took place or not is hardly the crux of the matter: the argument advanced by AA's supporters was that it was a big secret and if she knew of it she was familiar with high politics. In truth, it was widely spoken of, whether it took place or not, to the point that the German government felt compelled to deny it in 1915, so if she knew of it this proves nothing in her favour. The question is irrelevant in discussion of who AA was or was not. It also makes little sense for Ernst Ludwig to have worried about the trip becoming known, since the sole documentary evidence relating to it (as opposed to reported sightings) is in letters written by the Crown Prince and suggesting that the government mooted it. It did not, therefore, constitute a treason that EL would have needed to hush up. As I have pointed out here in the past, the issue of of far more interest in relation to EL and German politics than Anna Anderson. In her case, it is, as I say, pretty irrelevant.

Please also note that the books "Resurrection of the Romanovs" and "Fate of the Romanovs" were written by Greg King and Penny Wilson - NOT by Greg King solo. To both authors belongs the praise or blame. As Greg posts in this thread perhaps you could address your points to him instead of making these swipes about what you think "King" believes as if you were talking behind his back.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 03, 2011, 01:54:23 PM
     Re Reply # 145, et al. :  I have read the book, "Carisbrooke, and agree with you, Rob and the others, that the case is closed, door slammed and nailed shut. They are all well and truly dead.  What I particularly prized about King and Wilson, was their documention, even in silly things that have been a bone of contention around here, with the "girlie" fans pussy-footing around the subject of Anastasia's weight near and at the end.  She was NOT merely-overweight, but "fat, dumpy, etc." by documention. If you so chance to see on the various websites photos of themselves , the mosr vociferous of her apologists, note that they too, are certainly carrying their own bit of weight.  I supposed the "passionate ones" try to seize upon a similiatiry to closer identify with their attachment:  "If it's alright for a grandduchess to be 'fat,' then I'm ok, too. Pass the ice cream!"  For those who are attracted to morbity ("EXACTLY HOW did Anastasia die?" has been a discussion on here), there is a sufficient description here, enough to streak their mascara.
     IMO, the value of these two following quotes, are alone worth the price of the book (emphasises MINE):   Page 333  1.)  "Anastasia was an UNREMARKABLE young woman when she stepped across the threshold of that cellar room in the Ipatiev House; it was her rumored survival as Anna Anderson that made her extraordinary."  Then (speaking Of FS), page 334: " And she (FS) has an oddly vocal group of modern critics, THOSE WITH NO CONNECTION TO THE STORY but, who ruled by SENTIMENTAL NOSTALGIA for the vanished Romanovs, disdain the very mention of her name insisting that discussiion somehow insults the memory of the real Anastasia."  Bottom line:  No FS, no AN, other than a footnote that the family perished together. No cartoon, no dolls ("figures"), plastic tiaras, musicboxes, etc.
     The book is well work reading, but I suspect it will not get to the groupies that SHOULD read it, probably being considered too weighty to read and digest.                                              Regards,  AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 03, 2011, 02:21:05 PM
Well...That is still the Japanese finding that the bones in the mine is not Nicholas II, by using the sweat particules of his long dead brother Grand Duke George and the son of his sister Grand Duchess Olga Alexandrovna. That IS an important finding that Greg King "brushed aside" in his book "The Fate Of The Romanovs" but that finding is DNA based too. You cannot have favour one DNA finding when another DNA finding tells you another. I do not want to comment here, but it seems people here accept that DNA is 100% infallable !  hense I decided to throw this in. If the bones in the mine is not Nicholas II then AA is not FF too. Also do remember that Japanese team had the applause of the Russian Othodox Church who decided to bury the bones as "Christian Saints of the Revolution" rather than as the Imperial Family.

Eric, You don't even have your facts right. "Sweat particules" had nothing to do with it.  The first Japanese test was done on a stain on the handkerchief with Nicholas' blood from Otsu.  This was the original mis match. However, the provenance of the handkerchief indicated that it had been handled my MANY people over the years who could have contaminated it with their own DNA. That is the main reason why it was not as "reliable" as other testing... The next test was done from Nicholas' remains and the remains of Grand Duke George Alexandrovich and they were a PERFECT MATCH! A second retest of the Otsu material came from an identified blood stain and the second test matched Nicholas and George EXACTLY.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Eric_Lowe on January 03, 2011, 02:28:28 PM
Dear Janet,

I did reread "The Fate of The Romanovs" again. I did NOT see a more scientific comparisons between the results of the Japanese test and the other tests. You cannot simply made a statement (Do remember DNA is a science and not a verdict and need close studying). I did not dispute what conclusion that came to, but not all parts of it was explained as others in great detail. On the Ernie trip on the book, it was also glossed over (not explained in more detail). Yes, it is not as important as the DNA test, but it is another pillar to be knocked down, but it was not done in the same detail as other parts. I don't think it was irrelevent. Also In making these points I am not disputing that AA was not Anastasia or that she might not be FF. I am just listing some points that I find could deal with more in detail. Greg King & Penny Wilson had did a good job in both books and I am the first to applauded that excellent efforts and great grounds that have covered. However it is neither perfect or totally without questions unanswered as Greg had put forth in his foreword. I would love a point to point discussion, but do not want to be drawn onto a black and white argument either you are for or against Greg & Penny. No. It is about facts and how the argument is put forward.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on January 03, 2011, 05:19:23 PM
Dear Janet,

I did reread "The Fate of The Romanovs" again. I did NOT see a more scientific comparisons between the results of the Japanese test and the other tests. You cannot simply made a statement (Do remember DNA is a science and not a verdict and need close studying).

I don't need the reminder, thanks.
No, a DNA result is not a "verdict". It indicates a probability, which taken in conjunction with other indicators and evidence inform one's personal opinion. Just as in that chapter of FOTR. I don't understand what further evidence you expected you see. You should be aware that the original FSS tests reached their conclusion based on a number of different perspectives, including the relationship between the individuals in the grave and the relationship with known relatives of the Romanovs. Nagai's result was a wild card which did not challenge the great majority of the FFS results in any way, and the authors were criticized for giving it such attention in the name of openness - they were pretty much accused by some of trying to leave the door "open" for AA to be Anastasia. The irony.

I would love a point to point discussion, but do not want to be drawn onto a black and white argument either you are for or against Greg & Penny. No. It is about facts and how the argument is put forward.

Who is attempting to draw you into such a fatuous discussion? I'm not I hope generally known for "black and white arguments", but for speaking in a direct manner on points of historical discussion.  I don't really care whether you or anyone else is "for or against Greg & Penny" - is this a playground when we all choose our "sides"? I challenge your logic and your evidence and ask you to speak politely in the interests of adult discussion, as a courtesy to the forum owners who have made it clear that this what they want. I have far more interest in Ernst Ludwig than AA, and will have my say on him or any other matter that interests me and is relevant to this thread. They are my personal views. I may agree or disagree with friends or strangers on any topic, but I have certainly never felt the need to abuse someone because I had a different view on some matter of history, still less be part of some internet "gang" on someone's "side". Good grief.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 03, 2011, 10:07:02 PM
If I can try to steer this back to point (and perhaps all DNA questions should go into some new thread in the Myth of Survivors under an FS heading or something):

Originally we did deal with the alleged 1916 trip by Ernie at great length-but it got cut because we had to cut the word count from 160,000 to 140,000. In the end, we agreed that the important point about it was not whether it had taken place or not-it was whether the ALLEGATIONS about it were so secret that AA's mention of them revealed intimate knowledge only Anastasia would have possessed. And as we show, clearly the answer to this was no.

The arguments about the trip belong to another book or issue but seemed ultimately out of place in a book on AA because it was knowledge of the alleged visit, not the visit itself, that was key.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 03, 2011, 11:46:15 PM
And to punctuate Mr. King's point, please stay on topic. Mr. Lowe, discussions of FOTR belong on a different thread, not this one.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 04, 2011, 03:56:16 AM
'The five generations is not an average, it is the actually the fastest it mutates. It might not mutate for 8 or 10 generations, it seems to have never mutated more frequently than five, so they use five as the fastest mutation calculation.'

So any genetic link between FS and Anastasia was a minimum 25 generations back, and could be a lot more.

Many thanks for clearing that up.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 04, 2011, 10:20:52 AM
FA  Thank you for the explanation.  It had me finally thinking that I understand but then Janet said:

"No, a DNA result is not a "verdict". It indicates a probability, which taken in conjunction with other indicators and evidence inform one's personal opinion" 

That is the kind of statement (and Janet please forgive me, I am not at all slamming you, I am just confused) that does confuse me!

I feel like a complete "dummer Esel" when it comes to all of this.  I am sorry FA, you have done a great job of explaining.

The whole Alixz and Zelda connection made a lot of sense.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 04, 2011, 10:23:38 AM
Also interesting from an mtDNA standpoint, it seems that the mtDNA found in Franziska's/AA's body is exceedingly rare especially as compared to the so-called Victorian mtDNA shared by female descendants from Queen Victoria, including the Empress and her daughters.

During the 1990's, I was contacted by a family that had paid to have Princess Catherine of Yugoslavia's mtDNA collected and tested because they thought their late mother was a missing Grand Duchess. When it was later claimed that the British crown had manipulated the test results on Prince Philip (the Empress' nephew) and AA, we were able to blow the conspiracy theorists out of the water. Not only was the Duke of Edinburgh's mtDNA sequenced before we knew what AA's mtDNA sequence was, but we had private test results done before the DofE's which exactly matched his and the Empress' - even though all the subjects were of different generations.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 04, 2011, 10:40:34 AM
"No, a DNA result is not a "verdict". It indicates a probability, which taken in conjunction with other indicators and evidence inform one's personal opinion" 

'That is the kind of statement (and Janet please forgive me, I am not at all slamming you, I am just confused) that does confuse me!'

I think the point is that DNA did not give 'absolute' yes/no results, more that it can show with a very high degree of probability whether, for example, two people are closely related or not. For example (and forgive me if I've got this wrong), the minimum of five generations between mutations means that, with five differences between the mtDNA sequences of Anastasia and Anna Anderson means that there is a very high probability of at least 25 generations between them and any common female-line ancestor.

Taking four generations per century, this puts any putative common ancestor at least 600 years back, to roughly 1300.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 04, 2011, 10:45:06 AM
FA  Thank you for the explanation.  It had me finally thinking that I understand but then Janet said:

"No, a DNA result is not a "verdict". It indicates a probability, which taken in conjunction with other indicators and evidence inform one's personal opinion" 

That is the kind of statement (and Janet please forgive me, I am not at all slamming you, I am just confused) that does confuse me!

I feel like a complete "dummer Esel" when it comes to all of this.  I am sorry FA, you have done a great job of explaining.

The whole Alixz and Zelda connection made a lot of sense.



There is always a scientific "possiblility" that a mutation "might" have spontaneously occured in a more recent generation. Now don't read a lot into this. The "probability" that this happened in the AA testing was found to be ONE TRILLION to one.  This is science speak for "it almost certainly didn't happen but we still have to allow for that chance that this is the first time in a TRILLION human births that it might have".  Does that reduce your confusion??

 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 04, 2011, 10:56:38 AM
I think it does.  Trillions (check out the National debt) are almost too much to comprehend in any form, but that is one heck of a lot of people!

It is clearer now.

Thank you, again.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 04, 2011, 12:27:37 PM
"No, a DNA result is not a "verdict". It indicates a probability, which taken in conjunction with other indicators and evidence inform one's personal opinion" 

'That is the kind of statement (and Janet please forgive me, I am not at all slamming you, I am just confused) that does confuse me!'

I think the point is that DNA did not give 'absolute' yes/no results, more that it can show with a very high degree of probability whether, for example, two people are closely related or not. For example (and forgive me if I've got this wrong), the minimum of five generations between mutations means that, with five differences between the mtDNA sequences of Anastasia and Anna Anderson means that there is a very high probability of at least 25 generations between them and any common female-line ancestor.

Taking four generations per century, this puts any putative common ancestor at least 600 years back, to roughly 1300.

Ann


Think of it this way. The mtDNA is better at "no" than yes". So, we knew by the mid 1990's that AA could not have been closely related to Alexandra. We did not know who she could be related to, but there was no doubt about the "no". No, she was not related to QV, the Empress, or the DofE. No.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Penny_Wilson on January 04, 2011, 07:22:52 PM
Hey Everyone!  I thought I'd just stick my head up and say "hello" for the first time in a long time.  I'm pretty busy at work these days -- I manage a bodybuilding gym owned by a bodybuilder friend, so that's sort of a new interest of mine.  =)   But FINALLY our Anastasia book is out there!  I know Greg and I look forward to discussing it, and explaining how it developed and grew.  Writing it was a roller-coaster -- but it's always fun to work with Greg.  So -- I'm here and ready to talk Anastasia whenever you all are!

 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 04, 2011, 07:25:37 PM
Re Reply # 167:  Welcome back, Penny!  I DO have the book and appreciate your and Greg's efforts (and especially the documentation)!  Best wishes for the New Year!   Regards,   AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 04, 2011, 07:27:17 PM
I've just started it today.  So far I like what i have read. 

Well done, both of you.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 04, 2011, 08:26:03 PM
Welcome back, Penny! I hope you will contribute when you can, loved yours and Greg's newest!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 05, 2011, 06:16:25 AM
Well, it seems AA/FS changed her story more than I changed my socks, it's a wonder the woman had any credibility at all.  However, it seems that the Fox Mulder mentality was in play here, namely "I Want To Believe."

I can understand those Russian exiles and how they must have felt.  Their country had been virtually stolen from them, they had been driven out, and I can see them clinging to ANY hope of bringing back the old ways, no matter how small that hope was.  From what I have read so far, the whole thing was helped by second hand information.  Someone saw or heard something and it just snowballed.  No doubt some were in it for the money, but I think others really believed, or WANTED to believe.  The Dowager Empress refused to give up hope that Nicky and his family was alive unitil the end of her life, and everyone just let her go on believing it.  Of course, who wants to tell a sick old woman that two of her sons, her daughter-in-law, and five of her grandchildren have been brutally murdered.  AA/FS only muddied the waters further.

Of course, back then, no one really knew what had happened to the Imperial Family.  From their viewpoint, they had just disappeared in 1918.  When the Whites took Ekaterinburg, there was evidence that something terrible had happened, but no direct proof.  Namely no bodies.  The Soviets, by covering up their crimes, added to the confusion.


Excellent book.  I recognize a few names on the acknowledgement pages from here :)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 05, 2011, 06:36:22 AM
Tim

I agree with all you say.

I think a lot of the exiles wanted to believe that SOMEONE had survived, and so concentrated on the 'positive indications' that suggested that Anna Anderson could be Anastasia - her apparent recall of minor details, for example. Others were cautious and concentrated on the 'negative indications'. Others still felt sorry for Anna Anderson (not surprisingly, in all the circumstances). Of course, all the meetings she had with various exiles and people who had actually known the family - the patients in the Tsarskoe-Selo hospital, for example, gave her more nuggests of information which she made use of. And sometimes being 'too traumatised' to see anyone or remember anything was very convenient!

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 05, 2011, 11:05:22 AM
Yeah, as I said, part of the problem was, at that point, there was no real evidence that Anastasia was dead.

Non-Believer:  Anastasia was murdered in 1918.

Believer:  Oh yeah, can you show me her body, a picture of her body, or produce a witness that saw her die?

Non-Believer:  Uh, no.

Believer:  Well, so much for your argument.

AA and those around her profitted from this lack of evidence on the other side, and those that wanted to believe Anastasia had lived.  Now we know she didn't, but back then the question was open.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on January 05, 2011, 05:58:02 PM
Well...That is still the Japanese finding that the bones in the mine is not Nicholas II, by using the sweat particules of his long dead brother Grand Duke George and the son of his sister Grand Duchess Olga Alexandrovna. That IS an important finding that Greg King "brushed aside" in his book "The Fate Of The Romanovs" but that finding is DNA based too. You cannot have favour one DNA finding when another DNA finding tells you another. I do not want to comment here, but it seems people here accept that DNA is 100% infallable !  hense I decided to throw this in. If the bones in the mine is not Nicholas II then AA is not FF too. Also do remember that Japanese team had the applause of the Russian Othodox Church who decided to bury the bones as "Christian Saints of the Revolution" rather than as the Imperial Family.

Hi Eric, for clarification on why the Nagai results can't really be taken too seriously, you can read this article that Margarita Nelipa and I wrote a few years ago (originally published in European History Journal)  http://www.facebook.com/notes.php?id=102002640405&notes_tab=app_2347471856#!/note.php?note_id=124212444290669 

BTW, DNA evidence is - for all intents and purposes - IS a DEFINITIVE verdict, not just "probability". To say otherwise, once again, shows a misunderstanding of DNA science.  ;)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on January 05, 2011, 07:00:01 PM
Hey Everyone!  I thought I'd just stick my head up and say "hello" for the first time in a long time.  I'm pretty busy at work these days -- I manage a bodybuilding gym owned by a bodybuilder friend, so that's sort of a new interest of mine.  =)   But FINALLY our Anastasia book is out there!  I know Greg and I look forward to discussing it, and explaining how it developed and grew.  Writing it was a roller-coaster -- but it's always fun to work with Greg.  So -- I'm here and ready to talk Anastasia whenever you all are!

 

 Penny,

So good to hear from you, again.

The whole process of our learning about AA was a wild ride
(http://img.photobucket.com/albums/v667/Obesemia/spaceteddy.jpg)
from the beginning to your  published book.   And,  I am so very happy that I don't have to fly anymore space ships after  climbing  off the fence I've been perched for a long time.   If you remember,  I had promised to remain on the fence until the two of you publish your book which you both thought would prove to Bear and others that we were wrong in thinking AA was FS.    

Bear has to tell you both:  It has been fun watching the two of you  evolve  and grow into better researchers and authors.

Bear's conclusion is:  I think the majority of us are standing  and applauding  the both of  you because what you tried to do was to discover the truth and in doing so,  you realize AA might be FS and didn't stop until you were satisfied that you both had been wrong because AA was FS then put it on paper for all of us to read.  


All my best to the both of you.

AGRBear

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Robert_Hall on January 05, 2011, 07:11:21 PM
Despite our differences, I agree wholeheatedly with Bear. Indeed, a work well done. Congratulations !
 Robert
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 05, 2011, 08:24:34 PM
It seems to me that, in a way, FS was a tragic figure.  Apparenlty her original intentions were just to say "Hey, look at me, I'm somebody!  I'm Anastasia!"  If left alone, it probably would have ended there, but, as I said, others got involved and the whole thing just snowballed.  FS was just happy to be noticed, so she went along with it.  Soon it got so big that, even if she wanted to, she couldn't admit the truth.   She didn't want the rejection that would bring.  Towards the end of her life, though, she had lost interest.  When she moved to the U.S. and married Jack Manahan, it seemed she was done with the whole thing.  She just said:  "Either you believe or you don't believe."

I've also revised my opinion on Gleb Botkin.  For a long time I thought it he was in it for the money.  However, he really believed her.  He let this belief cloud his judgement, and he made enemies of the surviving Romanovs because of it.

All this because some poor misguided woman just wanted the world to know she was alive.  Sad.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 05, 2011, 10:22:36 PM
More to the point, I think Franziska had a deep desire to feel loved, to belong, and in the Romanovs she found something that had been lacking in her life-an idealized family, even if only by proxy. So while she certainly knew what she was doing, there is an undeniable psychological aspect to what happened that mitigates to some extent the effect it had on others. I don't know that she can be held completely responsible in the same way we might do with someone lacking her psychological background and overwhelming despair. That's why I think it's best to tread gingerly in assigning motives to her to fit preconceptions-she wasn't good nor evil, merely human, and clearly unequipped emotionally to make correct choices in life that would not harm others.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Nesterov on January 06, 2011, 03:02:49 AM
Hurrah, just got the book and beginning to read...

I am a bit confused - why does the introduction always write "Gudunov" (re Boris Godunov)? Is this an older or more correct form of the surname Godunov?

Also, it says on page 5 that the second Dimitri "fled to the town of Kostroma, where, in December 1610, he was killed."

But is this not Kaluga? All my sources state Kaluga. There is one source I have found for Kostroma, but that is Wikipedia (!). I cannot find the source used in the K&W book

I don't want to nit pick, it is just that I am a slow reader, because I pour over everything. I like to go slowly and absorb every sentence. I think I must be wrong, I usually am, I find, but if anyone else can add to this, they will be doing me a favor by correcting my own faulty knowledge.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Griae on January 06, 2011, 05:33:28 AM
My copy of the book arrived just before Christmas, and I have been reading it, although I have not finished the book yet. I find it a really readable book, the style is very easy. ( In Dutch we have the expression, 'it reads like a train', and this is such a book) Even my mum, who does not read in English looked through the book, read a few bits here and there and said 'I think even I can read this book and understand it'. So my compliments to the writers for their easy and well-readable style.

I am now reading the part about Anna Anderson and I am fascinated by the fact how facts were changed, how people told her things and gave her photographs and later people thought she could really remember things and people.

What a horrible situation it must have been for the family. Not knowing for sure what happened, hoping, against better judgement perhaps, that one of the family survived, this woman and all that does not add up, and always the hope that maybe, maybe, it might be true.

It seems very sad that this woman was so caught up in the fact that she was Anastasia. I do not know if she actually believed it herself, or that she said it and than it spiralled out of control and she could not stop anymore. I do not know what much about her, I am very new to reading about the Romanovs and all the things related to them, but I think when I finished this book, I will know more about AA and her motives.

greetings, Bettina



Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 06, 2011, 11:47:08 AM
Hurrah, just got the book and beginning to read...

I am a bit confused - why does the introduction always write "Gudunov" (re Boris Godunov)? Is this an older or more correct form of the surname Godunov?

Also, it says on page 5 that the second Dimitri "fled to the town of Kostroma, where, in December 1610, he was killed."

But is this not Kaluga? All my sources state Kaluga. There is one source I have found for Kostroma, but that is Wikipedia (!). I cannot find the source used in the K&W book

I don't want to nit pick, it is just that I am a slow reader, because I pour over everything. I like to go slowly and absorb every sentence. I think I must be wrong, I usually am, I find, but if anyone else can add to this, they will be doing me a favor by correcting my own faulty knowledge.



I can not speak specifically for Penny or Greg of course. However, as someone who read and re-read the earlier drafts to assist them, I can vouch for the fact that Penny and Greg were highly concerned with accuracy in their sources and materials. All of us who were privileged to have been asked to help were.  "Gudonov" is the more recognizable spelling of the name, at least in the US. As for the other re Dmitri, well, small mistakes "fall through the cracks" in every book, no matter who the author if that is the case. I'm certain someone will have the answer (and of course, in the end, what does it really matter where Dmitri was killed in 1610, in the story of AA three hundred plus years later??)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 06, 2011, 11:52:16 AM
Quote
I do not know if she actually believed it herself

It's possible that towards the end of her life, the Manahan years, that she did come to believe she was Anastasia.  She had been "playing the part" for decades by then.  As old age set in, she could have come to belief her own stories.  Of course, there is no way we'll ever know for sure.

Apparently, as he got old, Johnny Weismuller, who played Tarzan in a bunch of movies in the 1930's/40's, was sometimes found wandering his neighbourhood and doing the Tarzan yell.  Dementia had set in and he started to believe he WAS Tarzan.  Something similar could have happened to FS/AA.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Nesterov on January 06, 2011, 01:35:18 PM
"Gudonov" is the more recognizable spelling of the name, at least in the US. As for the other re Dmitri, well, small mistakes "fall through the cracks" in every book, no matter who the author if that is the case. I'm certain someone will have the answer (and of course, in the end, what does it really matter where Dmitri was killed in 1610, in the story of AA three hundred plus years later??)

I thank you, that is very interesting for me! I am glad to have that information from such an important source as the Forum Administrator himself!

I just asked about the other thing because sometimes when I start a book and I see a small mistake, I start to lose my faith in what will come next. I could not find the exact source for this information in the bibliography. But there is quite a difference between Kaluga and Kostroma, it is like two different US states! But I think I am probably wrong also there, because I did not know that the proper name was Gudunov, for example. The book certainly reads well, flows well.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 06, 2011, 03:40:20 PM
Tsarfan - Long time!  Good to see you!

Hope all is well or at least acceptable.

I have not yet finished the book, but I am still working on it.  It is amazing how so many things were believed to be unrelated to AA's knowledge, but it makes sense that those who thought she was ANR would just talk to her about the past.  I am sure that AA picked up a lot of her "insider" information that way.

I haven't gotten to the FS part yet.  I am currently on Gleb Botkin et al.

It is still a mystery to me as to when FS decided that she could "become" Anastasia but the why is clear.  Those in the hospital with her gave her the idea.  She was actually brave to take on the role.  She could have bombed and she must have known that might happen.  That is probably why she fell back on her "injuries" as the reason that she couldn't remember.  It was a good cover and those who truly wanted to believe wouldn't want to hurt her feelings any more than they thought those feelings had already been hurt.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 06, 2011, 08:13:28 PM
Hi, Alixz.  I've got a lot going on still that has kept me away from Russian history for a while:  retirement, a move, transition to caregiver role.

But I've waded back in recently to bone up for a couple of lectures I'm going to be giving on Russian history, and the publication of the new King and Wilson book was just too much temptation to start posting again.  I was so glad to see real analytic rigor brought to a subject that has suffered so long for having been too much a part of popular mythology.  Especially with all the nonsense going on in Russia these days with a new wave of historical revision about the monarchical era and the ROC's politically-driven posturing about Romanov remains, it was refreshing to see an insertion of true, disciplined historiography back into the picture.  I know the question of a surviving grand duchess is a bit of a sideshow to the central flow of Russian history.  But as probably ten times the number of people follow this kind of saga rather than political, social, and economic history, it does acquaint a larger audience with real tools of proper analysis.  And to me, that is really where King's and Wilson's work shines here.

I see you've been busy as a moderator.  Hands full, huh?
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 06, 2011, 08:40:49 PM
Hurrah, just got the book and beginning to read...

I am a bit confused - why does the introduction always write "Gudunov" (re Boris Godunov)? Is this an older or more correct form of the surname Godunov?

Also, it says on page 5 that the second Dimitri "fled to the town of Kostroma, where, in December 1610, he was killed."

But is this not Kaluga? All my sources state Kaluga. There is one source I have found for Kostroma, but that is Wikipedia (!). I cannot find the source used in the K&W book

I don't want to nit pick, it is just that I am a slow reader, because I pour over everything. I like to go slowly and absorb every sentence. I think I must be wrong, I usually am, I find, but if anyone else can add to this, they will be doing me a favor by correcting my own faulty knowledge.



I can not speak specifically for Penny or Greg of course. However, as someone who read and re-read the earlier drafts to assist them, I can vouch for the fact that Penny and Greg were highly concerned with accuracy in their sources and materials. All of us who were privileged to have been asked to help were.  "Gudonov" is the more recognizable spelling of the name, at least in the US. As for the other re Dmitri, well, small mistakes "fall through the cracks" in every book, no matter who the author if that is the case. I'm certain someone will have the answer (and of course, in the end, what does it really matter where Dmitri was killed in 1610, in the story of AA three hundred plus years later??)

Thanks Rob-and I am sure there ARE somemistakes in it-there always are in any book that is published-things that escape checking at the point when eyes are glazed over after reading it the eighteenth time.

And along with other people here noted in the acknowledgements I do want to say a big public thank you to Rob, who went above and beyond to help out this book, especially at a time when he had many other issues with which to deal.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 07, 2011, 04:07:14 AM
I'm certainly not going to trash this book, which I think is extremely good.

There is, however, one point which I found extremely interesting and worth developing (though I take Greg's point that he had to make some drastic cuts in the length of the book). That is that the examination of Anastasia's teeth showed features associated with congenital syphiliis. This certainly surprised me. Based on what we know Alexandra could only have got syphilis from Nicholas, whose only other sexual partner that we know of was Mathilde K, who lived to be 95, so presumably didn't have syphilis or was successfully treated in the early stages. Could some of Alexandra's ill-health have been syphilis?

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 07, 2011, 05:31:12 AM
I'm certainly not going to trash this book, which I think is extremely good.

There is, however, one point which I found extremely interesting and worth developing (though I take Greg's point that he had to make some drastic cuts in the length of the book). That is that the examination of Anastasia's teeth showed features associated with congenital syphiliis. This certainly surprised me. Based on what we know Alexandra could only have got syphilis from Nicholas, whose only other sexual partner that we know of was Mathilde K, who lived to be 95, so presumably didn't have syphilis or was successfully treated in the early stages. Could some of Alexandra's ill-health have been syphilis?

Ann


Uhm...you MIGHT want to read that section again before certain elements go berserk! We ACTUALLY wrote that Anna Anderson's teeth-not Anastasia-revealed the signs of one or both of her parents having had congenital syphilis! Nothing to do with Anastasia unless you believe Anna Anderson was the Grand Duchess!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 07, 2011, 05:41:11 AM
Apologies!! I'm writing this at work and haven't got the book to hand!

If it was Anna Anderson who had congenital syphilis then the picture changes entirely.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 07, 2011, 09:05:59 AM
I just finished the book this morning.  I read late last night and then finished at about 6:30 AM.

Wonderful!  I know that I should have made notes.  I know there are things that I would like to discuss, but I realized that after I posted yesterday that Franciska was quite bold to have done what she did, it seems that she was actually found out several times, but somehow the nostalgia and pain on the part of the Russian Refugees and the incomprehensible waffling of the Duke of Leuchtenberg helped her to pull this off.

So much now makes sense.  By the way, I did understand that it was Anderson's teeth which showed signs of inherited syphilis and when I read that I had an "Aha!" moment.  It would never have crossed my mind that either Nicholas of Alix would ever have had syphilis and so that would show, to me, that Anderson was not and never could be Anastasia.

Oh and those pesky "ears". Have we please heard the last of them, yet?  (Praying ever so strongly.)

One question.  The hair found in the basement of the bookstore in the box of books saved from Manahan's estate.  It has been said that it was kept in sterile conditions in a safe deposit box.  However, how sterile were the conditions in Manahan's house or in the box that contained the books or even in the basement of the bookstore itself?  And how many others might have looked through that box as it was packed and then placed in the basement of the bookstore?  Might others who were interested in the books ever looked at or touched the hair samples during the time before Susan Grindstaff Burkhart found them?

But I want to say, "I knew it!"  I could never believe that any Grand Duchess or any other person brought up under the close supervision of Alexandra in the nursery at Tsarskoe Selo and within the close confines under which the four Grand Duchesses were raised could ever have devolved into the course, unkempt, slovenly woman who was Anastasia Manahan.

I also believe that, if any of the Grand Duchesses had survived Yekaterinburg, she would have bee able to go directly to a close relative like Grand Duchess Olga Alexandrovna and tell her something that would immediately identify her as Olga's niece.  Olga would not have rejected someone who was truly a Grand Duchess just for the money involved.  That would be the end of story - case closed.

The only off thing that I found was a picture on page 219 of Anderson which was compared to a picture of Grand Duchess Anastasia in 1920 and I was again struck by the resemblance, not to Anastasia, but to Tatiana.  But since Tatiana didn't have "hallux valgus" that deception would have been easy to unmask.

I wonder if Franciska found out about the foot condition that both she and Anastasia shared and then thought that it might help her out?

Kudos to Greg and Penney.  A wonderful, readable, intelligently presented book.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Louis_Charles on January 07, 2011, 09:33:08 AM
Greg,

Congrats to you and Penny, the book is just terrific. This case has fascinated me for years, and continues to do so. Not because I thought AA=ANR (the DNA evidence and the Lovell book pretty much took care of that years ago), but because I have always wanted to know how FS pulled it off. The Resurrection of the Romanovs gives the most lucid explanation of the process imaginable, along with a wealth of new information.  Going to start re-reading it this weekend!

Best,

Simon
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 07, 2011, 11:26:59 AM
Kind of sad how Franciska's family basically turned their backs on her.  The woman needed help, and all they could think was "If she goes down for this, she'll take us with her!" 

Besides, from what was revealed of Franciska's backgroud, that her father may have sexually abused her and her mother didn't give a damn, it's no wonder she might attach herself to a close knit family like the Romanovs.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on January 07, 2011, 02:36:06 PM
FA  Thank you for the explanation.  It had me finally thinking that I understand but then Janet said:

"No, a DNA result is not a "verdict". It indicates a probability, which taken in conjunction with other indicators and evidence inform one's personal opinion" 

That is the kind of statement (and Janet please forgive me, I am not at all slamming you, I am just confused) that does confuse me!





No problem, I know just what you mean. It doesn't help that some authors (Mangold and Summers spring to mind, though to be fair they did admit they knew little about DNA) have used the whole probability issue rather disingenuously to suggest that the verdicts can not be relied on. As Rob says, the probability AGAINST is usually very small. But it wrong to say that the judgement made does not involve an element which is not scientific. Peter Gill and others have developed what they call a "Likelihood Ratio" for their results, but his former employer, the FSS, even disputes the need for it.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on January 07, 2011, 02:44:42 PM
Nicholas, whose only other sexual partner that we know of was Mathilde K,


This is OT, but (if I don;t raise t here it won;t come up unless I dedicate a thread to rumours about Nicholas's love life...)....not necessarily. She's the only one who can be named for sure, but there were reports of another ballerina (Labunskaia), employed by Alexander to educate his heir, of an opera singer (though the historiography of this suggests that she and Labunskaia might be one and the same), and of a geisha named Oei or Ei while in Japan.

Incidentally, Carolly Erickson wrote in her bio of Alexandra that Petersburg gossip asked if Nicholas had syphilis. Her source for this is the fact that Philippe Vachot treated syphilis. In truth, I have never seen one piece of evidence that anyone thought the syphilis fact significant, since Vachot treated many other things; Erickson simply made that up for dramatic effect. But this is how stories get started...

Anyway, I need to go write a paper refuting outrageous claims made by western historians that the Empress Alexandra suffered from syphilis...:-D :-D :-D
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 07, 2011, 04:46:12 PM
Given Franciska's background, it wouldn't surprise me if a few nasty diseases were there.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 07, 2011, 06:07:21 PM

Regarding the hair found in the bookstore. What happened prior to it being found is not pertinent as far as where it was stored. The finder just took extreme care once she did find it because she understood the importance of chain of custody and not contaminating the sample any further.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 07, 2011, 06:19:11 PM
Lisa, Thank you.  That makes sense.  Chain of custody has ruined a lot of court cases.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 07, 2011, 10:12:33 PM
And by now I doubt I am spoiling anything by pointing out the NEW DNA tests done for the book that again prove, using more reliable technology and standards, that AA was FS. That was hair from the same clump Susan found in 1990. She had had her hair in a safe deposit box-me, my hair was sitting here for twenty years in a picture frame. But it STILL rendered identical mitochondrial and nuclear DNA results to the 1994 tests-and actually upped the odds she was FS by examining more STR markers. Legally-and we had to check-the chain of custody issue is a non-issue for both my hair, for Susan's hair, and especially for the bowel tissue tested.

Dr. Michael Coble and Dr. Daniele Podini, who did this new DNA test on AA (and Dr. Coble helped identify the two sets of remains found in the Koptyaki Forest in 2007), MAY publish these results of their testing; if not I will make available the data containing specific alleles tested and what was found. But they also did a likelihood ratio based on the rarity of the mtDNA shared by AA and Karl Maucher-and they estimated that it was 4100 times more likely that AA was FS than that she was not-vastly better odds than Gill et all got in 1994.

But you can rest assured that nothing bizarre went wrong with the hair as far as it legally being in an acceptable chain of custody.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 07, 2011, 11:12:32 PM
You don't have to convince me, Greg, I agree.  AA was FS, and Anastasia was murdered with the rest of her family on that terrible day in 1918.  No one survived the bullets of those Bolshevik murderers.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 08, 2011, 07:08:00 AM
A question for Greg and Penny:  I don't believe that I have seen this asked/discussed elsewhere, EVER.  The subject is the potential family origin of AA(FS)' eye color.  Always included in the lists of "proofs" that the supporters of AA put forth was the presence in AA(FS) of the variously described styles of how her eye color was like the Emperor's.  The coloring is also sometimes given the fanciful name of "Anastasia Blue," I believe.  At that time, one's genetic eye coloring could not be permanently altered (as indeed it can today only be "changed" by different iris-colored contact lenses as used often in movies). My question is two-fold:  Is it known that anyone else in FS' close family structure had the same eye coloring (even down to today)?  Would not the PREVALENT eye color of the Kashubians primarily tend to be dark ?  Does it follow that FS' strange/similiar eye color was simply a coincidental mutation that was rushed forward as "relative proof (pun intended)" of her Imperial descent by "believers/supporters" ?  Thanks in advance for your thoughts/comments.     Regards,  AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 08, 2011, 08:21:01 AM
Don't we have to turn to Mendel and his peas when it comes to eye color and the dominant/recessive traits that sometimes show up?

For example.  My mother's eyes are blue.  My father's were hazel (a combination of brown and green)  My sister's eyes are blue but my eyes are green. No one came up with truly brown eyes and that should have been the dominant color.  Blue is recessive and the green - in this case is truly recessive.

However with my son.  My husband's eyes are brown and, of course, mine are green.  Our son's eyes are hazel (that is that combination of brown and green again).

Perhaps sometime in the past generations of Franciska's family there was marriage outside of the Kashubian genetic.  Remember that the book says that the territory where the family lived was controlled over the years by Swedes and Teutonic Knights as well as Prussians and Russians.  The Swedes and Teutonic Knights and the Prussians would have had blue eyes either dominant or recessive.  But it would be interesting to know if any of Franciska's siblings had dominant blue eye traits.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 08, 2011, 08:31:09 AM
Franciska was one very "lucky" woman when it came to things that make you go "oooh".  She had the foot disorder, she had the blue eyes, she was the right height, she had scars and previously broken bones.

What a strange convergence of all things physical that could and did make people (especially those who had not seen Anastasia since before 1914) think that Franciska just could be the "real thing".
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 08, 2011, 11:16:39 AM
Indeed, Mendel's recessive traits crop up in many unexpected places.  I had a close friend in high school who's parents were dark Eastern European and their son, my friend, had snow white hair and Elizabeth Taylor eyes, yet he looked otherwise exactly like his dad.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 08, 2011, 11:34:13 AM
'Don't we have to turn to Mendel and his peas when it comes to eye color and the dominant/recessive traits that sometimes show up?'

Yes. To take another example. My maternal grandmother had black hair and brown eyes. She married a man with brown hair and blue eyes. They produced two black-haired brown-eyed sons, one son with dark brown hair and green eyes and a daughter with dark-brown hair and grey-blue eyes. The eldest son (black hair, brown eyes), married and produced two dark-haired brown-eyed sons, of whom one has two similar daughters). My mother married my fair-haired blue-eyed father and produced a son and daughter, both fair-haired and blue-eyed.

Odd things do happen. My brother and I look strikingly like our father and not at all like our mother. However, I have the same eyebrows (if rather less bushy!) than my maternal great-great-grandfather, and the same astigmatism in my left eye.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 08, 2011, 11:37:34 AM
Quote
Perhaps sometime in the past generations of Franciska's family there was marriage outside of the Kashubian genetic.  Remember that the book says that the territory where the family lived was controlled over the years by Swedes and Teutonic Knights as well as Prussians and Russians


That's true, back then that area changed hands a lot.  In Nicholas II's time, what we now call Poland was divided between the Russian and German Empires (Russia had the bigger part, all the Imperial Family's hunting lodges were in that area).  It's only been since the end of World War II that the area has been stable.

So marrying between different ethnic groups is not surprising.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 08, 2011, 11:55:47 AM
Indeed, the postulations (G. Mendel, et al.) are valid.  The responses are appreciated! But isn't it remarkable that "she (AA) has eye color exactly like my sister/friend/student (FS), etc." is seemingly not known to have come forth publically from those who were old enough to have clearly remembered FS (the Meyers, etc.). As stated, eye colors cannot be changed in the same person..  To my recollection, while the shape of the face, height, voice, gait, etc, were commented upon regarding the comparasion of AA with FS, the duplicate eye colors are apparently never mentioned! It would appear that in the contest to identify, everyone was "blinded by the light" of their remembrance/s of the Emperor's eyes and to BELIEVE! To use a wry, but true pun: "If you want to hide something, put it in plain sight!"  Luck. luck, luck!  (I am still hoping to hear of a documented contemporary reference to the eye color similiarity/duplication in AA and FS.)    Regards,  AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 08, 2011, 12:50:23 PM
OK, this is getting a little OT even for me. Please keep the discussions here to the specifics in the book. For other discussions, I will start a new topic in the Myths of Survivors thread, something like, How AA/FS pulled off the imposter act.

http://forum.alexanderpalace.org/index.php?topic=16006.0
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 08, 2011, 05:41:40 PM
FA  How she pulled it off is part of the book.  The Franciska section talks about what she did and didn't say and how much she picked up from those who were "blinded by the light" of their own remembrances of the Tsar and his eyes and/or Anastasia and her face and eyes, etc.

I think it does belong here, but then you are FA and I am not.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LadyTudorRose on January 08, 2011, 11:22:57 PM
I had to order my copy and it got delayed because of the snow storm, so I didn't get it until last week. I finished it a few days ago and was really impressed. I found myself feeling really bad for Franciska; if my life was that horrible I'd probably want to pretend to be someone else too.

Everyone has at some point in their life found themselves in a series of lies that spiraled out of control, and you get paranoid about getting found out and feel sick and uneasy until it's all smoothed over. Well, for Franciska it turned into her whole life. The book made it seem like she never had any intention of it getting as big as it did or lasting for the rest of her life.

I did not have much sympathy for Harriet Rathlef-Keilmann and the like. This book did make me more willing to believe Gleb Botkin wasn't in on it, but surely some of her other supporters (like the aforementioned Rathlef-Keilmann) had to have figured out she wasn't actually Anastasia or at least realized the good chance that she might not be. Yet they continued to lie and cause problems for Anastasia's family because they didn't "recognize" her. On her own I don't think Franciska would have stirred up so much unpleasantness. It wasn't in her best interest to get anyone's family involved. For her supporters, they had very little to lose and all the more to gain by going for high profile recognitions. But for Franciska she was constantly at risk for being arrested, or for the time the Nazis were in power, killed. I can only imagine how terrified she was when she encountered people who knew her in her former life. To me it demonstrates some level of acting ability that she didn't completely break down out of fear. Being caught in a lie, or even almost caught, is a really unpleasant experience. The bigger the lie, the worse it feels. When Doris Wingender greeted her after all those years, she probably had to keep herself from passing out.

As wrong as what she did was, I feel like she probably got punished enough in the hell of her own making. Even after she knew she wouldn't get caught, and had stopped caring whether people believed her, I don't think she was every really comfortable as Anastasia.




Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 08, 2011, 11:28:41 PM
Boy, I'm glad others can discuss recessive genes and eye color-I have no clue as I freely admit.

But we're happy to discuss anything that we can about the book or evidence-I'll check between here and the section Rob created.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 08, 2011, 11:34:49 PM
I did not have much sympathy for Harriet Rathlef-Keilmann and the like. This book did make me more willing to believe Gleb Botkin wasn't in on it, but surely some of her other supporters (like the aforementioned Rathlef-Keilmann) had to have figured out she wasn't actually Anastasia or at least realized the good chance that she might not be. Yet they continued to lie and cause problems for Anastasia's family because they didn't "recognize" her.


Too many people have wanted to blame Gleb and Tatiana in this case, first pointing out they scarcely knew Anastasia and then just as adamantly insisting that they knew Anastasia "so well" that it was impossible that they did not know AA was not the Grand Duchess! But as we try to show, both of them were sincere in their beliefs-they just happened to be wrong about her identity. Gleb, it is true, let his troublesome nature loose and hurled unfounded accusations at everyone, though I think he probably did it for the same reason that someone like Rathlef-Keilmann, who probably DID actually believe that AA was Anastasia, did: That it was OK to "stretch the truth" on little things or change stories to make her case more believable in the service of a larger, just cause of proving that she was Anastasia. That's merely an opinion, but likely what led to a lot of these things taking place-self-justification for erasing AA's mistakes and rewriting portions of the tale to make it seem more plausible.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 09, 2011, 12:45:04 AM
To me, Rathlef-Keilmann came across as someone who knew she wasn't Anastasia, but was thinking:  "Oh boy, if we can convince everyone, we get access to the Tsar's fortune.  KA-CHINNNGGGG!!"  Back then there were rumours about the Tsar's lost fortune floating around. 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 09, 2011, 09:25:39 PM
I think Rathlef-Keilmann was more of a devotee who believed AA was Anastasia than someone who thought of her in terms of heiress to a Tsarist fortune.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 10, 2011, 04:06:10 PM
I guess I misread her then.   Truth is, it was hard to tell who really believed and who was just in it for this mythical fortune.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Penny_Wilson on January 10, 2011, 07:00:45 PM
Of course it's hard to second-guess the motivations of other people, but I just never got the idea that any of the early "Anastasians"  -- those involved before the organization of the Grandanor company -- were all that interested in the money potential.  They seemed to me to be true believers, each with a varying degree of ability to ignore and/or explain away contradictory evidence.

To me, this case is all very psychological -- on almost all sides!!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 11, 2011, 09:15:55 AM
Penny or Greg - would you post just what Grandanor is an acronym for?  I might have missed it, but I didn't think you put it in your book and I have forgotten the exact wording.

Thanks.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 11, 2011, 09:16:50 AM
I guess I misread her then.   Truth is, it was hard to tell who really believed and who was just in it for this mythical fortune.

I don't think any of the well-known names surrounding her that REALLY mattered in terms of recognizing her or supporting her were in it for the money-they all genuinely believed (this excepts a few of the more disreputable emigres in Berlin with whom she lived and mixed in these years).

It's one of the common misconceptions-that AA or her supporters were all out for money-and as we found and tried to show nothing could be more wrong. There's much that Gleb Botkin did with which one can disagree, but one thing I have always thought unfair-and can now support in the book-is the idea that he was attempting to use AA for personal enrichment. As Penny says, the GRANDANOR Corp was another issue but even there it was not personal gain for those true intimates of AA like Botkin.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Penny_Wilson on January 11, 2011, 09:32:47 AM
Penny or Greg - would you post just what Grandanor is an acronym for?  I might have missed it, but I didn't think you put it in your book and I have forgotten the exact wording.

Thanks.

Take the capital letters in this: GRANd Duchess Anastasia Of Russia = GRANDANOR.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 11, 2011, 09:37:04 AM
Thanks, Penny.  It was the "O" that I couldn't figure out.

Anyone who invested in that corporation certainly didn't get their money's worth, did they?
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 11, 2011, 12:03:18 PM
As I said, for years I thought Gleb Botkin was after money, but this book made me revise my opinion of him.  He really believed AA was Anastasia, or he really WANTED to believe her.  He was the one that suggested she come to the U.S. and was Best Man at hers and Jack Manahan's wedding.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Penny_Wilson on January 11, 2011, 03:22:45 PM
Thanks, Penny.  It was the "O" that I couldn't figure out.

Anyone who invested in that corporation certainly didn't get their money's worth, did they?


I believe they all went bankrupt, including Edward Fallows, the attorney who set it up.  His daughter (Annette?) was quite bitter about it for a long, long time.

I always think that Grandanor was kind of a cheesy name...
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 11, 2011, 04:32:57 PM
Well, in any event, it was a very good book, well written, well researhed.  My hat is off to both of you.

There was only one thing that bothered me, and it is minor.  I was uncomfortable with the repeated use of the term "execution" in reference to what happened in Ekaterinburg on July 17, 1918.  Execution made it sound like due process was followed, that there had been a trial in which the Romanovs could speak in their own defense.  Of course, no such event occurred (although I understand Trotsky was pushing for such a trial).

What happened on July 17, 1918 in that cellar was not an execution, it was cold blooded murder.  No more, no less.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Penny_Wilson on January 11, 2011, 05:14:48 PM

Interestingly, I asked two Romanov relatives during two different interviews how the family themselves called the killings.   One said that she thought that the answer to such a question mattered only to a romantic -- and she wasn't going to romanticize the events of July 1918.   And the other said that she's heard her husband and his immediate family use anything from "assassination" to "murder" to "killings" to "execution"  -- not that they spoke about it much.  Life moves on, she said, especially in subsequent generations. 

I wouldn't say that these were the opinions of all Romanovs; they're the opinions of the two I happened to ask.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 11, 2011, 08:00:02 PM
Interesting, but I guess since no Romanov living now actually knew Nicky and his family, they can "move on".  Maybe Nicky and his family being canonized by the Russian Orthodox Church helped.

Anyway, as I said, the book is great.  Thanks for writing it, both of you.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 11, 2011, 09:22:22 PM
You're welcome! Hopefully this answers questions in this case and offers new evidence that finally ends it
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 11, 2011, 11:13:40 PM
Well considering that there are still people out there who think the Earth is flat, I imagine there will be those who will hold to the idea that AA was Anastasia.  Anastasia's ghost could materialize in front of them and tell them first hand, and they STILL wouldn't believe she was murdered in 1918.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 11, 2011, 11:44:03 PM
Had a message from AP member Primrose pointing out something interesting that we never noticed:

Franziska's brother Michael was born on her birthday in 1899 but died in infancy. Her brother Valerian was born April 25 1900. So he must have been born at barely five months-premature-and Franziska's mother Marianna must have become pregnant again right away, especially as we were able to obtain and confirm the dates of birth with church registries and certificates.

Just wanted to clarify in case someone read that and thought it must be wrong
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Elisabeth on January 12, 2011, 06:55:44 AM
I've been everywhere this holiday season, and cannot find this book anywhere, despite all my best efforts. Is it only available on special order or something?

I think the question we should really ask is, to what extent was Anna Anderson/Franziscka Schanzkowska mentally ill? And to what extent was she a con artist? Both? I have no idea about the ultimate answers to these questions -- I am hoping Greg and Penny's book will supply answers to same -- but I suspect there are a lot of grey areas here. Which is to say, FS was never in reality AN, but she might truly have believed at times (AT TIMES!) that she was.

I just (re)watched the Leonardo DeCaprio movie Catch Me If You Can about the master con artist and check forger Frank Abignale Jr. who operated as a young adult during the 1960s and after his arrest ultimately became a special agent in the FBI check fraud unit. What was astonishing about him was first and foremost his incredible intelligence, which was obviously genius level, allowing him to pass as an airplane pilot, doctor, and lawyer, at various times during his juvenile career of nefarious impersonations ("how did you cheat the Louisiana bar exam, Frank?" "I studied for two weeks and then I took the test"). We underestimate these personalities at our own risk. Fortunately Abignale turned out to be "socially friendly" in the long run, and now works for Fortune 500 companies. But Anna Anderson? I sort of wonder if she was always a bit or even completely antisocial. I can't find the King and Wilson book anywhere, but I am yearning to read it for their take on such questions.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 12, 2011, 07:08:22 AM
No-it should have massive distribution across North America and now in Europe. I know it was selling very well and perhaps stores were out if they ordered it, but it should always be available though Amazon or Barnes and Noble or Chapters in Canada or any other major retail distributor. If all else fails, any bookstore should be able to easily order a copy if you prefer not to order through Amazon.

We try to assess AA's mentality as best as is possible. She certainly was, up to the 1960s, quite aware of what she was doing and knew very well that she was in fact Franziska. By the 1970s, perhaps she had actually come to believe the lie, but so much of what she did was quite deliberate and demonstrates how she made real efforts to pass herself off-not quite as a valid Grand Duchess-but as just enough of an enigma for people to always wonder-and therefore to continue the mystery and support her.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 12, 2011, 08:21:15 AM
I wonder whether in the latter stages of her life she was suffering from Alzheimer's Disease.

To my mind that would fit in with her living in increasing squalor, although she had previously reduced the barrack hut in Bavaria to squalor during the 1950s.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on January 12, 2011, 06:37:12 PM
Had a message from AP member Primrose pointing out something interesting that we never noticed:

Franziska's brother Michael was born on her birthday in 1899 but died in infancy. Her brother Valerian was born April 25 1900. So he must have been born at barely five months-premature-and Franziska's mother Marianna must have become pregnant again right away, especially as we were able to obtain and confirm the dates of birth with church registries and certificates.

Just wanted to clarify in case someone read that and thought it must be wrong

Greg,

Are you sure it wasn't 1901?

According to earlier posts,  this is what was written:

>>Family chart


Anton Schanskowsky (Schanzkowsky) m. (1) to 1890 to Josefina Peek
Issue: [unknown]
1. ?

Anton Schanskowsky m. (2) 1894 to Marianna Wiscek [Wilczek] b. 1866. Marriage ended in divorce abt 1910/1912. Both remarried. [Mother remarried to ___NN___ Knopf; no children listed]
Issue:
2. Martin Christian S. b. 16 November 1895
3. Franziska S. b. 16 December 1896 [date from Penny Wilson] also listed in some books as 22 December 1896, baptized 24 December 1896
4.  Gertrude S. b.  12 Nov 1898 m. ____ Ellerick
Children:
----- 1) Gertrud Ellerick m. __ Maucher Child was:
---------- (1) Carl Maucher +
-----2) Hedwig Ellerick m. __ Lander
----- 3) Margarete Ellerick+
----- 4) Magdalene Ellrick m. __ Weber Child was:
------------(1) Herbert Weber

5. Michael S. b. 16 December 1899
6. Valerian S. b. 25 April 1901
7. Felix S. b. 17 February 1903
8. Juliane Marianna S. (Maria Juliana) b. 30 April 1905

AGRBear<<

According to your last book, the name was, also, spelled Czenstkowski.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 12, 2011, 11:19:34 PM
Bear, we'd have to look back through to confirm now if the church registry says 1900 or 1901-and who knows where they are at the moment? It could be that 1900 is an error and it should be 1901. I DO know we actually had confirmation of the date-but the year could be mistake either here as 1901 or in the book as 1900, as unfortunately such things happen. Luckily it doesn't affect anything having to do with Franziska, though!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on January 13, 2011, 01:10:12 PM
More to the point, I think Franziska had a deep desire to feel loved, to belong, and in the Romanovs she found something that had been lacking in her life-an idealized family, even if only by proxy. So while she certainly knew what she was doing, there is an undeniable psychological aspect to what happened that mitigates to some extent the effect it had on others. I don't know that she can be held completely responsible in the same way we might do with someone lacking her psychological background and overwhelming despair. That's why I think it's best to tread gingerly in assigning motives to her to fit preconceptions-she wasn't good nor evil, merely human, and clearly unequipped emotionally to make correct choices in life that would not harm others.

I think this is an interesting point. (And congratulations and welcome back to both you and Penny!) I never believed that AA was Anastasia but I always felt (with no proof mind you) that she somehow believed it--either because of a mental illness, because she wanted it so badly, because she was sad and lonely, whatever the reason. She just seemed to cling so hard to the idea--not wavering from it--for so long and through so many battles. Other wannabes quickly fell by the wayside but she hung in there. I can agree with the earlier poster (Lisa?) who was 'incensed' with what she put the family through but at the same time feel pity because I don't believe (again, just my opinion) that she had the same hard-bitten motives that many claimants (and perhaps some of those around her) had. I always just found her a sad, pitiful figure.

I have bought all your books (from FOTR onward) for our library recently and look forward to adding this one as well.  :) I just wish the Grand Duke Ernst Ludwig one hadn't fallen away. One can always dream, I suppose.  :)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Penny_Wilson on January 13, 2011, 04:32:42 PM
I think this is an interesting point. (And congratulations and welcome back to both you and Penny!) I never believed that AA was Anastasia but I always felt (with no proof mind you) that she somehow believed it--either because of a mental illness, because she wanted it so badly, because she was sad and lonely, whatever the reason. She just seemed to cling so hard to the idea--not wavering from it--for so long and through so many battles. Other wannabes quickly fell by the wayside but she hung in there. I can agree with the earlier poster (Lisa?) who was 'incensed' with what she put the family through but at the same time feel pity because I don't believe (again, just my opinion) that she had the same hard-bitten motives that many claimants (and perhaps some of those around her) had. I always just found her a sad, pitiful figure.

I had never really thought that she was "in it for the money" because it became evident fairly soon that there wasn't any money to be had -- not really.  She just sort of eked out an existence, sometimes staying in palaces or Fifth Avenue apartments -- but just as often living in psychiatric clinics or a Quonset hut in the Black Forest.  

For a real con-artist, I think, the lack of any real cash and the freedom to do as she wanted would have meant a quick exit.  If she "disappeared" to get into the role, she could just as easily "disappear" to get out of it.  I believe the turning point for Franziska was the one occasion on which she did disappear for a few days and returned to her previous life.  Whatever those few days said to her, they propelled her back into the charade, and she never broke with it again.


Quote
I have bought all your books (from FOTR onward) for our library recently and look forward to adding this one as well.  :)


Thank you!

Quote
I just wish the Grand Duke Ernst Ludwig one hadn't fallen away. One can always dream, I suppose.  :)

I wouldn't worry too much!   King and Wilson will ride again soon -- and Ernst Ludwig could well be part of things!!!  ;)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 13, 2011, 08:01:43 PM
Quote
I believe the turning point for Franziska was the one occasion on which she did disappear for a few days and returned to her previous life.  Whatever those few days said to her, they propelled her back into the charade, and she never broke with it again

A role she kept playing until the day she died.  By then it was far too late.  Well, at least she found a kindred spirit in Jack Manahan.  He was just as eccentric as she was.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: matushka on January 14, 2011, 05:56:58 AM
Mr King, I wish to know if you could explain in your book the "Felix Dassel' case", in your book. This very story was still confusing for me, even if  I never believed Anna Anderson beeing AN, party because every traumatical death of famous people almost automatically call such an answer as claimant. Even in such a family as mine (nothing famous, I should say) we have our legende, our claim. Is seems to be a psychological reflex of self-defense before death or something else difficult.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 15, 2011, 05:22:17 PM
Interesting, but I guess since no Romanov living now actually knew Nicky and his family, they can "move on".

I know what you mean here, but in a way quite a few people, including some Romanovs, who actually knew Nicholas and Alexandra moved on, as it were.

For instance, Ella was so disgusted with their obtuseness in turning away warnings of the coming cataclysm that she made no attempt to visit her sister and her family during their captivity at Tsarskoye Selo.  And there was precious little sentiment in the White Army to put Nicholas back on the throne.  And his cousin George in England was willing to see the family go into captivity rather than risk discredit to the British crown.

Many people have commented over the years on the lack of credible, known attempts to rescue Nicholas and his family.  I think the reasons for that go well beyond the logistical difficulties.  In fact, I suspect that quite a few people who wanted a restoration of the monarchy would have viewed Nicholas' availability to step back into the role to be more of a problem than a solution.

Today many people have lost the sense of just how Nicholas was viewed in the aftermath of Bloody Sunday in 1905.  The outright revulsion of him personally as well as his government can be read simply by looking at the newspapers of the day in London, Paris, and New York.  And a different kind of frustration with his handling of things can be found in the private papers of his sister Olga and other family members.  In fact, the image of Nicholas that emerged from Bloody Sunday was the proximate cause of George's difficulty more than a decade later in extending sanctuary to him and his family.

In some ways, the people that seem to have the most trouble moving on are not Romanovs but today's starry-eyed romantics who keep dreaming of the princess who must, simply must, have survived.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 15, 2011, 05:48:11 PM
I don't think Nicholas would have wanted to rule again, even if it had been offered.  His writings give no indication of this.  He might have been more than happy to spend the rest of his life in exile on a farm somewhere sawing wood.

However bad a leader he may have been, it did NOT justify the brutal murder of himself and his family.  If a man is guilty of a crime, you put him on trial for said crime.  Of course, thugs and murderers like the Bolsheviks were didn't believe in due process.

Anyway, we're off topic again.  Sorry folks.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 15, 2011, 07:57:12 PM
A revolution is not a trial, and I'm afraid due process has very little to do with it.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 15, 2011, 08:02:51 PM
Quote
I'm afraid due process has very little to do with it

Of course not, when the criminals are the ones calling the shots.  The Bolsheviks were all thugs and murderers, not a decent human being among them.  The Russian people paid a terrible price for putting those murderers in power.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Penny_Wilson on January 15, 2011, 08:33:52 PM
Mr King, I wish to know if you could explain in your book the "Felix Dassel' case", in your book. This very story was still confusing for me, even if  I never believed Anna Anderson beeing AN, party because every traumatical death of famous people almost automatically call such an answer as claimant. Even in such a family as mine (nothing famous, I should say) we have our legende, our claim. Is seems to be a psychological reflex of self-defense before death or something else difficult.

Matushka, we take four or five pages to deconstruct the Dassel legend, but the short answer is that the legend relies almost solely on uncorroborated information, and omissions and incorrect information regarding the circumstances of Dassel's meeting with AA.  For example, AA's recognition of "Mandrifolie" as one of MN's nicknames would be far more compelling if anyone other than Dassel had ever recorded it.  And far from not knowing who her intended visitor was, the night before they met, Maria Baumgartner prepared AA to meet her guest by going over with her a commemorative album of MN and AN's hospital at Tsarskoye Selo.

Other pieces of information had been gleaned by AA beforehand:  She knew about the medallions given as souvenirs to the officers who recovered at MN and AN's hospital because she had seen one the year before and had had it explained to her extensively.  She corrected Dassel's "test" of placing the billiard table on the wrong floor of the hospital -- but she had a commemorative album with photos and captions.  All examples of Dassel's "recognition" can be explained away in similar fashion.

And of course, Dassel was a frequent visitor to the von Kleist apartment in Berlin in 1923 -- while AA was in residence.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 15, 2011, 08:52:05 PM
The Bolsheviks were all thugs and murderers, not a decent human being among them.  The Russian people paid a terrible price for putting those murderers in power.

This is not the thread to go into it, but I'm afraid the Russian people have paid a terrible price for bowing their heads to autocratic authority since at least the time of Ivan III.

You should take a look at some of the edicts of Peter the Great regarding conscription into state service, forced education with curricula established by the crown, central economic planning, and the subjugation of the church to state control with the Holy Synod.  And take a look at the numbers of people who died at forced labor during his reign.  Or look at the expansion of serfdom or the establishment of the Pale under the "enlightened" Catherine the Great.

As for due process, check out the "liberal tsar" Alexander II's personal overriding of jury verdicts and judges' sentences when they did not suit him.

The soviet era was in many ways just a particularly rocky run in the river on which Russian history has been sailing for centuries . . . and is still doing under Putin & Co.

(And the "Russian people" did very little to put those murdering Bolsheviks in power.  In fact, they had a rather messy civil war over it.  You might want to read up on one very nasty night at the telephone exchange in late 1917.)


___________

And okay, mods . . . I'll get back on topic.  Thanks.  
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 15, 2011, 11:23:16 PM
Mr King, I wish to know if you could explain in your book the "Felix Dassel' case", in your book. This very story was still confusing for me, even if  I never believed Anna Anderson beeing AN, party because every traumatical death of famous people almost automatically call such an answer as claimant. Even in such a family as mine (nothing famous, I should say) we have our legende, our claim. Is seems to be a psychological reflex of self-defense before death or something else difficult.

Matushka, we take four or five pages to deconstruct the Dassel legend, but the short answer is that the legend relies almost solely on uncorroborated information, and omissions and incorrect information regarding the circumstances of Dassel's meeting with AA.  For example, AA's recognition of "Mandrifolie" as one of MN's nicknames would be far more compelling if anyone other than Dassel had ever recorded it.  And far from not knowing who her intended visitor was, the night before they met, Maria Baumgartner prepared AA to meet her guest by going over with her a commemorative album of MN and AN's hospital at Tsarskoye Selo.

Other pieces of information had been gleaned by AA beforehand:  She knew about the medallions given as souvenirs to the officers who recovered at MN and AN's hospital because she had seen one the year before and had had it explained to her extensively.  She corrected Dassel's "test" of placing the billiard table on the wrong floor of the hospital -- but she had a commemorative album with photos and captions.  All examples of Dassel's "recognition" can be explained away in similar fashion.

And of course, Dassel was a frequent visitor to the von Kleist apartment in Berlin in 1923 -- while AA was in residence.




Hello, Penny:

                                I’ve read about AA being “warned” about Dassel’s visit to Seeon…but the detail I never understood is why he went there in order to “recognize” the claimant if he had seen her several times at the Von Kleists’s flan, in 1923. I’ve read Dassels’s account to his visit to Seeon Castle and it seems as if he was watching at AA’s face for the first time of his life. It wasn’t the case…Isn’t it that weird?

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 15, 2011, 11:27:25 PM
Sorry, I meant : "...the Von Kleists FLAT" , not FLAN  ::) , as it appears in my message above. My PC wouldn't allow me to make corrections if the message is too long.

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 15, 2011, 11:30:06 PM
Well, in any event, it was a very good book, well written, well researhed.  My hat is off to both of you.

There was only one thing that bothered me, and it is minor.  I was uncomfortable with the repeated use of the term "execution" in reference to what happened in Ekaterinburg on July 17, 1918.  Execution made it sound like due process was followed, that there had been a trial in which the Romanovs could speak in their own defense.  Of course, no such event occurred (although I understand Trotsky was pushing for such a trial).

What happened on July 17, 1918 in that cellar was not an execution, it was cold blooded murder.  No more, no less.

I share your opinion about the term: "execution". It was a murder. And I wrote a lot of times about why I don't like to write or say that the Imperial Family was "executed". Marie Antoinette and Louis XVI were executed. Charles I of England was executed. The Romanovs were murdered.

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 16, 2011, 02:35:29 AM
The problem is that none of the absolute terminology is one hundred percent accurate. For me, at least, it breaks down like this:

Assassination doesn't really work in any way, as it is suggestive of something that did not happen

Execution is a fitting term applied to Nicholas-it was in the middle of the revolution, it was a political act, it was carried out by revolutionaries in a direct effort to achieve both vengeance AND to remove any possibility that he could return to the throne, and it followed considerable meetings in which it was discussed-no matter if the outcome of those meetings was largely determined in advance.

This same principle applies perhaps to Alexei-as heir to the throne, he represented the old regime and a continued threat, and whatever political principles infused the Russian Revolution they certainly took into account the desire to erase the old regime and the possibility of its return.

The "execution" argument applies in somewhat the same way to Alexandra, though less than with her son and certainly less than with her husband. She was perceived as having had a major political role in the ruin of the country, so as with Nicholas and Alexei her death combined both vengeance with political retribution. In her case she was probably killed more out of animosity as she certainly represented no threat that the dynasty would continue.

But then when you get to the Grand Duchess execution doesn't fit. It can be argued they fell in the same political retribution that ensnared their parents and brother, but I am personally more comfortable with simply asserting that Olga, Tatiana, Maria and Anastasia were murdered.

This take may offend some, but it's a more nuanced view of the factors that led to the events in the Ipatiev House. Nicholas, to me, was clearly executed, and I think this is also the most correct way to describe the death of Alexei and, less certainly, that of Alexandra. But the four Grand Duchesses would have been murdered since their deaths served no political purpose
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Dominic_Albanese on January 16, 2011, 10:13:30 AM
I would take slight exception with the murder of the Grand Duchesses not having any political purposes...  Killing Olga, even though according to the Pauline Laws she couldn't inherit the throne, added to the chaos of no clear Romanov being able to remount the throne.  In the middle of the revolution, I could see the white army surrounding her as figure head and perhaps heir - especially after Nicholas, Alexi and Michael were dead.  I don't think there was any love of Kirill and she while a romantic figure, the rest of the family might have surrounded this smart and sensitive girl.  Complete conjecture, I agree but a possibility I believe none the less.  And I am sure it factored into the thinking of the thugs who decided all their fate.

dca
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Dominic_Albanese on January 16, 2011, 10:16:21 AM
And I should have added, I'm about 2/3's way through this book.  As usual Greg and Penny have taken a complex subject and brought it to the masses with much thought and analysis.  This book is a keeper and a must have for anyone who wants to truly understand the web that surrounded this bizzare women.  Thanks to both of them and here's hoping that there is another Romanov book swimming around in their minds as we speak...

dca
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 16, 2011, 10:26:27 AM
My two kopecks on the question:

"Execution" means to put to death according to a legal tribunal's orders pursuant to the law.
"Murder" is the intentional killing of another person.

While the killing of Nicholas and perhaps Alexei was for political purposes, to prevent the Whites from rallying behind the Emperor, it was not really done in accordance with any law or after a trial on the evidence.  Moscow wanted him dead. The Ekaterinburg Soviet made that happen.  They killed everyone so that nobody would be left alive to tell the tale. To me, it was murder of them all. A State ordered execution is almost always a public event, not a well kept secret hidden intentionally.  An unlawful MURDER however, is indeed a well kept secret hidden intentionally.

I use Murder, as that more accurately, IMO, reflects what happened.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 16, 2011, 11:31:55 AM
I agree, it was murder.  It was, for all intents and purposes, a hit.  Moscow (Lenin) was the Mafia Don that ordered the hit and the Ekaterinburg Soviet was the hit man that pulled the trigger.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 16, 2011, 01:53:50 PM
What if we just say they were splattered and let it go at that?

It avoids debate about motives, it describes what happened to all of them, and it entertains me.

By the way, there were more people killed in that room for non-political reasons than just a few pretty young women.  There was, for instance, a father of two and some people who were there out of personal loyalty rather than by virtue of having been born to an exceedingly privileged life where lesser humans were expected to bow and scrape before you.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 16, 2011, 02:38:08 PM
Ah, "Tsarfan," relatively to your "an exceedingly priviledged life" (tounge in cheek),  perhaps you missed the "fact" that "GrandDuchessAndrea" posted that OTMA and the Heir "scorned" their titles, thus perhaps indicating that they wished to be viewed as "less priviledged"?  I refer to her posting # 53, 01/13/11, "Re: IF's nicknames-----they weren't meant for us," and again more specifically reaffirmed in her Post #58 of the same topic. You will notice that I have asked her to back this, IMO, absurd remark with authentic, documented quotes, but of course, she hasn't, dodges the challenge, and I think can't or won't produce anything of the sort (Reference Posts # 56 and 59).  
  But this is the same individual who today asks for the correct spelling of the "Kitchen Boy" 's name, when approximately 22 pages of responses about him are available here with little or no research effort/s.  How many times has the FA pointed out to research such trivial items, without relying on someone else to do it for them?   With regards, and a Happy New Year to you,  AP
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 16, 2011, 11:52:23 PM
Execution is sort of a catch-all phrase. Nuance is sometimes best left unexpressed when you reach the end of a book and have to figure out a way to suddenly cut out 20,000+ words because you went over the limit set by the publisher.

But back to the book....
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 17, 2011, 03:30:38 AM
Personally, I would call it murder, and not differentiate between the killing of any of the 11 people in the basement of the Ipatiev House. 'Execution' implies a proper legal process. The word is also used from time to time of the Mafia and similar organisations killing off their ex-adherents and the like, but implies a cold-blooded efficiency in killing which was certainly not a part of the occasion we are talking about.

If you want a reasonably 'neutral' term, then 'killing' seems to fit the bill.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: matushka on January 17, 2011, 06:24:05 AM
Many thanks, Mrs Wilson for your answer. As RealAnastasia, I was not aware that Anna Anderson already met Felix Dassel in 1923, a fact which change of course the whole story!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 17, 2011, 06:57:52 AM
Personally, I would call it murder, and not differentiate between the killing of any of the 11 people in the basement of the Ipatiev House. 'Execution' implies a proper legal process. The word is also used from time to time of the Mafia and similar organisations killing off their ex-adherents and the like, but implies a cold-blooded efficiency in killing which was certainly not a part of the occasion we are talking about.

If you want a reasonably 'neutral' term, then 'killing' seems to fit the bill.

Ann

Except "killing" is a clunky term as a descriptor. But the issue of execution vs. murder vs. assassination is best dealt with in another thread I should think and can only ever come down to opinion
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: MademoiselleAndrea on January 17, 2011, 10:52:07 AM
aleksandr pavlovich, I am not "dodging the challenge" to post evidence as to OTMA scorning their titles, in fact I searched a bit today after reading your post which was rather offending to me, for I know for a fact that I read an anecdote somewhere that mentioned OTMA not liking to be called "Your Highness", to the extent that one of the girls displayed her dislike for the title quite openly. I have many other things to do than scour the Internet for a little anecdote which I know I shall come across eventually, and in that event, post it. As to the spelling of Lenoid Sednev's name, the fact that there was a big thread about him over in "Servants, Friends and Retainers" simply slipped my mind. Forgive me for an off-topic post, but I feel it is my right to defend myself from untrue presumptions.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RichC on January 17, 2011, 12:15:29 PM
aleksandr pavlovich, I am not "dodging the challenge" to post evidence as to OTMA scorning their titles, in fact I searched a bit today after reading your post which was rather offending to me, for I know for a fact that I read an anecdote somewhere that mentioned OTMA not liking to be called "Your Highness", to the extent that one of the girls displayed her dislike for the title quite openly. I have many other things to do than scour the Internet for a little anecdote which I know I shall come across eventually, and in that event, post it. As to the spelling of Lenoid Sednev's name, the fact that there was a big thread about him over in "Servants, Friends and Retainers" simply slipped my mind. Forgive me for an off-topic post, but I feel it is my right to defend myself from untrue presumptions.

GrandDuchessAndrea, is this the well known anecdote you were thinking of?

From Nicholas & Alexandra, Part 2, Chapter 11, page 128, first edition:

Within the household, they were addressed in simple Russian fashion, using their names and patronyms: Olga Nicholaievna, Tatiana Nicholaievna.  When there were addressed in public by their full ceremonial titles, the girls were embarrassed.  Once at a meeting of the committee of which Tatiana was honorary president, Baroness Buxhoeveden began by saying, "May it please Your Imperial Highness..."  Tatiana stared in astonishment and, when the Baroness sat down, kicked her violently under the table.  "Are you crazy to speak to me like that?' she whispered.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 17, 2011, 12:40:56 PM
Re Post # 263 and "RichC":   Thank you for your attempt to help this "GrandDuchessAndrea" out of her situation, but I have already referred to the single same instance (with other sources quoting the SAME example) in my previous post to her. (Likewise I had commented on the given name, patronymic, etc. usage.) Thus she has this information already. As you can see, it specifically relates to TN.  Also see my upcoming post,#265.  Many thanks!   AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 17, 2011, 12:46:24 PM
   "Re "GrandDuchessAndrea" and Post # 262:  Thank you for your, IMO, essentially non-productive response, after having to be again reminded.  
    BUT OF COURSE, you read an "anectdote/illustration" re that "one of the girls displayed her dislike for the title quite openly" :  I REPEATED/GAVE/openly posted it to you in my previous commentaries:  You may read it for yourself in the latest King and Wilson book (THEIR references for this single incident:  Pierre Gilliard's "Thirteen Years at the Russian Court", page 75/ Buxhoeveden,  'Life and Tragedy," page 158) that I have likewise quoted for you (the person was Grandduchess TN, who kicked a lady-in-waiting under the table for using "Imperial Highness.")  We ALL know THAT one, but where are quotes (PLURAL) that you wish to offer as "proof" for the "scorn" that the ENTIRE OTMA AND THE HEIR exhibited, and reaffirmed as such in your two posts?
    Feigning "offense" and not having enough time are very simplistic/convenient excuses. As you know, other youngsters like yourself, have the potential to believe whatever they see written here as "truth," and to date you have not conclusively PROVEN your statement/s.  Lesson to be learned:  Don't post "facts" if you are not willing to back them up with evidence when asked. To take on this responsibility is a courtesy to ALWAYS be extended.  Surely you should have learned that in your albeit somewhat limited, research in (middle?) school. I will look forward for the other documented, authentic quotes and sources......... IF and WHEN you ever produce such.  Regards,  AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: StevenL on January 17, 2011, 02:50:57 PM
Greg and Penny,

Heartfelt congratulations on another amazingly interesting history and, above all, an insightful treatment of a remarkable 20th-century phenomenon. I enjoyed it immensely. ... As with FOTR, my only regret concerning "Resurrection" is not to be able to read everything that was cut out in order to meet the publisher's requirements.

Best,
Steven Lavallee
Providence
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 17, 2011, 04:16:01 PM
To Penny Wilson and Greg King:  I echo "Steven's" comments in Post # 266.  I am particularily appreciative of your all-important documentation of the sources. Additionally, the captioning at the top of the pages of (foot)notes (i.e. "Notes To Pages 142-152") is immensely helpful in quickly locating a specific source follow-up.  I am now on my third reading of the volume, and I, too, would regret that the content of the book had to be shortened to meet the requirements of the publisher. Best regards,   AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: MademoiselleAndrea on January 17, 2011, 05:34:57 PM
Aleksandr pavlovich, I am not making up excuses. The reasons I gave were throughly true. Also, you did not GIVE the anecdote to me, you merely mentioned it and did not post the whole text. (and I must have not read it thorughly the first time.) Thank you, RichC for posting the anecdote, that is indeed the one I was thinking of. If Tatiana, who was thought to be the most dignifed of the Grand Duchesses, kicked a lady-in-waiting for calling her Your Highness, I can only think that the rest of the girls, (but I do not know about Alexei, I think that he rather liked being called "Your Highness" and given the treatment according to his rank,) would not like it either! Now, I know you are going to harass me for not having a valid source for this, but really, why must we always have documented evidence for everything we post? Forums are for expressing opinions, among other things. And one more thing--"Feigning offense"? I did not feign offense! I was, and am, truly insulted by your posts. Also, I do not believe everything seen here as truth. It seems that you are expecting me to live up to your expectations, which I do not have to do.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 17, 2011, 06:05:47 PM
 Re Post # 268 and "GrandDuchessAndrea":  And NOW, we can understand at last that you CANNOT prove/support your original points/statement of "scorned," and have AGAIN "waffled", by now excluding the Heir as a "scorner" of title/s , yet you had SPECIFICALLY included him, as you originally stated, twice. (Additionally, you will recall that you had earlier, when questioned, "adjusted" your original "IF" designation, to exclude from the "scorned" statement, the "Emperor and Empress.)
 There is no "harassment"; you were asked to take the responsibility for the validity of your statement/s and your responses rapidly became more and more convoluted in subsequent attempts to explain that in actuality via authentic, documented sources, you couldn't. It is easy to now see that what you believe is a "fact" is in reality what you THINK it to be, even resorting to "extended/imaginary" reasoning:  Reread your fifth sentence (beginning "If Tatiana....") carefully.
  IMO, you have finally answered my question/s and for that, I thank you.  I therefore have no further need to comment on the matter.  Regards, AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Louis_Charles on January 17, 2011, 10:11:38 PM
Okay, kids, time out for everybody.

I have a question about Jack Manahan. He is an interesting figure to me in all of this, because he was with her for the end of her life. I used to see them eating out in Charlottesville when I was a student, and his reputation was that of an eccentric who became much more of one after the marriage. Greg or Penny: do you have any feeling as to whether he was ultimately aware that she was not ANR? Or was he the last true believer, so to speak?

Simon
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 18, 2011, 01:03:03 AM
I get a smile reading the Acknowledgement page.  I recognize quite a few names from here :)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 18, 2011, 06:14:01 AM
Okay, kids, time out for everybody.

I have a question about Jack Manahan. He is an interesting figure to me in all of this, because he was with her for the end of her life. I used to see them eating out in Charlottesville when I was a student, and his reputation was that of an eccentric who became much more of one after the marriage. Greg or Penny: do you have any feeling as to whether he was ultimately aware that she was not ANR? Or was he the last true believer, so to speak?

Simon

With thanks as always for the previous kind post about the book-just don't want to clutter things up.

Now-Jack: I am SURE he believed she was Anastasia-but then Jack believed almost anything. If anything, he made her even WORSE-more eccentric, more paranoid, and he was certainly responsible for much of the claptrap about "doubles" and people attributing to her stories of "no massacre" and the rest. I think it's pretty clear HE was the one who believed in all of this revisionist nonsense.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Ilana on January 18, 2011, 11:26:43 AM
I'm about 2/3 through this and am about to read about Franziska...

It kept running through my head..."why not get Anna Vyrubova to see her....".  Do you really their reasons for not asking her to give her opinion were really strong enough?  It seemed so lame to me.  She had been with the family daily for so long...I sort of think that would have trumped Rasputin involvement.  Maybe though, that's hindsight.

Enjoying book immensely Greg and Penny, good job!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 18, 2011, 11:55:19 AM
Quote
Now-Jack: I am SURE he believed she was Anastasia-but then Jack believed almost anything. If anything, he made her even WORSE-more eccentric, more paranoid, and he was certainly responsible for much of the claptrap about "doubles" and people attributing to her stories of "no massacre" and the rest. I think it's pretty clear HE was the one who believed in all of this revisionist nonsense.

Yeah, they made quite a pair, those two.  Jack thought that KGB assasins had killed Anna, not natural causes.  Of course, she was 87 years old (FS's actual age when she died).
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Annette on January 18, 2011, 02:32:42 PM
Hi Greg/Penny

Am 3/4 of the way through the book, superb. 

Kindest regards.

Annette
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 18, 2011, 07:03:03 PM
I'm about 2/3 through this and am about to read about Franziska...

It kept running through my head..."why not get Anna Vyrubova to see her....".  Do you really their reasons for not asking her to give her opinion were really strong enough?  It seemed so lame to me.  She had been with the family daily for so long...I sort of think that would have trumped Rasputin involvement.  Maybe though, that's hindsight.

Enjoying book immensely Greg and Penny, good job!

To my knowledge, Vyrubova never tried to see AA and AA's supporters believed that AV's well known devotion to Rasputin would make any recognition rather embarrassing. Which to me is rather ridiculous.

Three people who survived the Revolution who had either lived with the IF or nearly so never met AA: Grand Duchess Marie Pavlovna (the younger), Grand Duke Dmitri Pavlovich, and Anna Vyrubova. None of them ever met AA nor were asked to, AFAIK.

Pity, any of them could have cleared matters up in moments.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 18, 2011, 08:05:20 PM
Just thought I'd write my own review of this book.


BOOK: Resurrection Of The Romanovs
AUTHORS: Greg King and Penny Wilson
 
In 1920, a mysterious young woman was pulled out of a Berlin canal after apparently trying to commit suicide. No one knew who she was or where she had come from. In time, this woman made a spectacular claim, that she was, in fact, the Grand Duchess Anastasia, the youngest daughter of Tsar Nicholas II of Russia. Nicholas, along with his whole family, had been murdered by the Bolsheviks in the Russian city of Ekaterinburg on July 17, 1918, so how could this woman be Anastasia? For the next six decades, this woman, who came to be known as Anna Anderson, maintained her claim, supported by some, rejected by others. The court case to prove her claim was the longest in German history, spanning more than thirty years. In the end, they could neither accept or reject her claim, so no one won. As for Anna Anderson herself, she moved to the United States in 1968, married a man named Jack Manahan (and took his last name), and lived there for the rest of her life. She died in 1984, and at the time it seemed the secret had died with her.

Years after her death, two key events would lead to her claim finally being debunked. The fall of the Soviet Union, which led to the discovery of the remains of the Romanov Family, and the advent of DNA research. DNA tests proved once and for all that Anna Anderson Manahan was not Anastasia, nor was she related to the Tsar in any way. In fact, her real name was Franziska Schanzkowska, and she was born in 1896 in what we now call Poland (making her five years older than Anastasia, who was born in 1901). The jig was up.

Although her true identity had been unmasked, questions remained. Why did she do it? And HOW did she do it?

This excellent book seeks to answer the questions posted by this nearly century old story. Greg King and Penny Wilson undertook years of research to answer these questions. The book really is amazing in all the facts it uncovers. Much of what I assumed in the case turned out to be wrong, and it is easy to see why. While this book reinforces some long standing rumours, it totally destroys others.

Throughout the years of her claim, Anderson was surrounded by three groups. Those that truly believed her, those that wanted to believe her, and, finally, those who were in it for the money (it was rumoured at the time that Tsar Nicholas II had a fortune stashed in a back somewhere in Europe, if Anderson had turned out to be Anastasia, she could claim said fortune and those that helped might get a nice payoff). It was mostly these people that helped spread the rumours around. A lot of testimony thought to be accurate turned out to be hearsay (meaning that the person quoted was not an actual witness, but was told of the events by someone else). Others who met Anderson had only seen glimpses of the real Anastasia years previous, so they could not be sure one way or the other. Finally, since at the time no one really knew what had become of the Tsar and his family, the Bolsheviks had covered up the crime, there was no proof that the real Anastasia was dead.

Also, those that could have identified the real Anastasia refused to do so. The Dowager Empress Marie, the mother of the Tsar, could have done so. However, at this time, she was in failing health and refused to believe that her son and his family had been murdered. Of course, the family did not want to upset her, so they left her alone (in fact they did not really start challenging Anderson’s claim until after Marie’s death).

All in all, Mr. King and Ms. Wilson wrote a great book that looks at all the details of this case. A must-read for anyone interested in the tragic Romanov Family, like yours truly.

I give it a 10/10.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Naslednik Norvezhskiy on January 18, 2011, 10:02:51 PM
Tim, I think I'll review your review by pointing out that it would be fine if the audience was only vaguely familiar with the Romanovs and Anna Anderson, because you use most of it to retell the tale, but you don't say much about how it was written, what it told you that you didn't know already and if - and then how - it altered your view of Anna Anderson and the people involved in her case.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 18, 2011, 11:14:36 PM
Thanks for the kind words Tim

As for Anna Vyrubova: Honestly, truly, neither side wanted to ask her. I know that a few of AA's modern critics have run round saying that this was merely AA's supporters and that THEY were making excuses because Anna would expose AA-but this is not true. In the Staatsarchiv, as we point out in the book, there are a number of letters exchanged between Lord Mountbatten, Prince Ludwig and his wife Princess Margaret about asking Vyrubova to meet AA. And after numerous exchanges they, too-just as Tatiana Botkin said-decided it was best "not to bring Anna Vyrubova into it" because of her relationship with Rasputin. Mountbatten was particularly funny about it, writing something like, "It would just make that crazy old aunt of mine (Alexandra) look even crazier if her monk got dragged into it."

So neither side wanted her involved.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 19, 2011, 03:51:04 AM
'Three people who survived the Revolution who had either lived with the IF or nearly so never met AA: Grand Duchess Marie Pavlovna (the younger), Grand Duke Dmitri Pavlovich, and Anna Vyrubova. None of them ever met AA nor were asked to, AFAIK.'

Interesting about Dimitri and Marie Pavlovna. I can quite see why no one wanted to involve Anna Vyrubova, but not Dimitri or his sister.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 19, 2011, 05:40:37 AM

Mountbatten was particularly funny about it, writing something like, "It would just make that crazy old aunt of mine (Alexandra) look even crazier if her monk got dragged into it."

So neither side wanted her involved.


My suspicion is that both sides viewed Anna Vyrubova as too much of a wild card to pull into anything.  There was a fairly widespread view among the extended Romanov family and the upper echelons of St. Petersburg society that both Alexandra and her friend Anya were rather silly women prone to hysterics.  Rasputin was the worst of it surely, but the emotional instability of their relationship emerged from time to time in other ways, such as in the episode when Alexandra became suspicious that Anna had developed a crush on Nicholas.

Having Anna Vyrubova on your side in a dispute would not necessarily be a good thing.

And, of course, Dmitri was known to be either a murderer or a murder conspirator.  And his sister Maria was rather a wilting flower, under the thumbs of so many people throughout her earlier years, that she was viewed -- perhaps wrongly -- as highly susceptible to taking her cues from others.

The Romanovs and their close friends weren't the best fruit stand for picking cherries you'd want to serve at a party.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 19, 2011, 06:18:33 AM
Tim, I think I'll review your review by pointing out that it would be fine if the audience was only vaguely familiar with the Romanovs and Anna Anderson, because you use most of it to retell the tale, but you don't say much about how it was written, what it told you that you didn't know already and if - and then how - it altered your view of Anna Anderson and the people involved in her case.

Does this review get closer to what you're seeking? (It's on amazon.com)
_________________________

Others have and will comment here on the story of a minor ruse that grew into a worldwide legend that is adroitly recounted in this book. But I want to discuss this book for what I think is its most remarkable aspect: a tour-de-force deconstruction of how false history can be invented by letting the desire, sometimes almost unconscious, for a certain outcome dictate the presentation and interpretation of evidence.

Greg King and Penny Wilson were ideally suited to this task. Not only were they accomplished historians of late imperial Russia, but both thought for years that Anna Anderson might really be the Grand Duchess Anastasia, supposedly massacred along with her family in 1918. More than most other advocates for the view of Anastasia's survival, they were deeply versed in the myriad evidence that had been put forth for almost ninety years in support of this claim. But the 1990's began to unsettle the picture, as discoveries of bodies in a remote Russian forest and DNA testing of those bodies and of tissue samples of a now-deceased Anna Anderson deepened the doubts surrounding Anderson's famous claim.

In light of this emerging evidence, King and Wilson began to show their mettle as historians and to reassess their own long-held convictions. As this process brought them to serious doubt of Anna Anderson's claim, there was one hurdle they still could not easily clear. Since 1920 there had been claims that Anna Anderson, who was originally dubbed "Miss Unknown" by Berlin police who fished her out of a canal after a suicide attempt, was, in fact, known by some to be a Polish woman who had come to Berlin seeking work in the wartime factories then being staffed largely by women. But, while Anna Anderson might be no Grand Duchess, King and Wilson felt there had to be some other missing piece to the puzzle that would preclude her being a Polish factory worker. And they set out to find it.

What they instead found was a remarkable manipulation of evidence that had begun almost immediately upon Anna Anderson's emergence into the limelight of royal pretender status. This manipulation of evidence was deliberately cynical in some hands but more often guilelessly inadvertent in others. However, as the romance of the prospect that a pretty, 17-year-old princess had mysteriously been saved from a brutal political massacre seized the world's imagination, the manipulation of evidence acquired a life of its own. The cumulative effect was that comments haltingly made, opinions heavily caveated, affidavits for limited purposes were all seized upon as proof positive that the crusty, eccentric little woman being toasted in the press and hosted and then housed by a growing array of high society was most certainly a missing Russian Grand Duchess. Through a process of repetition of this purported evidence, with each step further removed from the original sources, the conviction set in among many that Anna Anderson's identity was a matter of conclusive proof.

What King and Wilson, in fact, found as they revisited the early sources and put fresh eyes on them was something else entirely. Small amounts of often anecdotal information in favor of Anderson's claim had been hyped massively by the press and acolytes. Much larger amounts of countervailing information, gathered with more rigor for the more disciplined purpose of determining the truth instead of a hot-selling headline, had been dismissed by a popular postwar imagination that needed a lost princess more than it needed a reminder that Russia was now irreversibly in the hands of a communist dictatorship.

The process that King and Wilson deconstruct in this book by which myth can morph into history is not only fascinating. It is an object lesson to all students of Russian history right now.

Russia is moving toward the brink of becoming a failed state, with a population in steep decline, regions along the border with a China bursting at the seams emptying themselves of Russians, a breakdown of the old soviet system of dodgy public services being replaced with nothing but press manipulation by a governing cabal holding onto power for the sake of power itself. With government policy failing on front after front, Russian leaders are doing their best to romanticize a past, the vision of which they hope will hold an ugly present at bay.

This new book by Greg King and Penny Wilson should be read not only by those who want to witness the spinning of a popular legend of missing royalty from the fabric of poverty and mental instability. It should be read by those who want to understand how the study of history, when put in the service of romantic desire, can be the most most deceptive of studies.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: matushka on January 19, 2011, 07:14:14 AM

Mountbatten was particularly funny about it, writing something like, "It would just make that crazy old aunt of mine (Alexandra) look even crazier if her monk got dragged into it."
Incredible words coming from a non Romanov! I had no idea this kind of statement about Alexandra was common outside Russia and the Romanov family. Was it also the opinion of Victoria, mother of Mountbatten? It shows once more how far the misinformation about Rasputin came. How could Rasputin be mixed in the case of recognizing or not a claimant. Anna Vyrubova was not only Rasputin fervent but first of all a person who saw the Grand Duchess on a daily basis during many years.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 19, 2011, 07:27:09 AM
Mountbatten was not a Romanov, but he made much of being Nicholas and Alexandra's nephew.

Matushka, I would disagree with you. Anna Vyrubova's devotion to Rasputin was highly relevant to her reliability as a witness.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on January 19, 2011, 12:52:12 PM


And, of course, Dmitri was known to be either a murderer or a murder conspirator.  And his sister Maria was rather a wilting flower, under the thumbs of so many people throughout her earlier years, that she was viewed -- perhaps wrongly -- as highly susceptible to taking her cues from others.

The Romanovs and their close friends weren't the best fruit stand for picking cherries you'd want to serve at a party.


I'd think Maria was viewed as extremely willful, rather than easily influenced?

It is perfectly possible that Dmitri himself made it clear that he would not go within a million miles of anyone claiming to be the Grand Duchess, such was his shame and disgust at his own role the Rasputin business. And Maria did though tend to take her cues from him.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Janet Ashton on January 19, 2011, 01:03:30 PM

Incredible words coming from a non Romanov! I had no idea this kind of statement about Alexandra was common outside Russia and the Romanov family. Was it aslo the opinion of Victoria, mother of Mountbatten? It shows once more how far the misinformation about Rasputin came. How could Rasputin be mixed in the case of recognizing or not a claimant. Anna Vyrubova was not only Rasputin fervent but first of all a person who saw the Grand Duchess on a daily basis during many years.



No, it was not the view of Victoria, who felt that her sister had been harmed by association with Rasputin, but also by the conscious behaviour of a coterie at court who had tried to damage her from the start. Mountbatten however made statements of this type several times, including to his parents' biographer, describing his aunt as "that crazy lunatic" who he said was nevertheless "absolutely sweet and charming". It's a little inappropriate when you think that his own sister spent several years in a sanatorium, under the impression that she was having a sexual relationship with Christ - but that matter was not publicly known and was not therefore a matter of public shame to him that he needed to comment on. Equally, what did he make of his Uncle Ernst's association with Graf Keyserling, another Rasputin figure for sure?

Mountbatten's most insightful statement on AA seems to me to be his remark - quoted in the book -  that he would not meet her since he was not in a position to judge who she was as he had not seen his cousin since childhood. I am not sure he even remembered the last time he saw her, as he always told people that it was in Darmstadt in 1913 - and yet she was not in Darmstadt that year.
Sigismund of Prussia should probably have taken such a judicious stance on her as well......
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 19, 2011, 04:06:37 PM
. . . his own sister spent several years in a sanatorium, under the impression that she was having a sexual relationship with Christ . . . .

Alexandra believing in miracle healers and soothsayers.  (Rasputin was not her first, by the way.)

Alexandra believing she had a son due to bathing in water blessed by St. Seraphim.  (I wonder what she thought of Seraphim's little joke in giving the son hemophilia.)

Nicholas combing his hair with a magic comb.

Mountbatten's sister believing she had sex with Jesus.

There's nothing like inbreeding to make the sauce spicy. 





Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 19, 2011, 04:23:50 PM

I'd think Maria was viewed as extremely willful, rather than easily influenced?



That was certainly the family's excuse to keep her under their thumb.  GD Ella was quite strict with her when Maria was in her care, and Maria always deferred to her brother in the management of her affairs before the revolution, getting an allowance from him rather than handling her income on her own, if I remember correctly.

She didn't really come into her own until the revolution set her adrift, and I think the family after that was always a bit unsure of whether the filly once broken had remained broken.  There was a certain vengeful tone to her autobiography . . . and I can't say I blamed her.

However, I do think the net effect was to make the adherents and opponents of Anna Anderson unsure whether Maria would tow whatever line the family wanted her to tow or whether she'd speak her own mind.  Compare this to Olga A., whom few had real reason to doubt would speak her mind.

(Personally, I don't think there was a Romanov "family line" regarding Anderson's identity.  Unlike many, I think the family members just wanted the truth to prevail, and most simply didn't believe the claim.  However, at the pitch of the battle in the 1920's, there were all kinds of suspicions about the family's agenda in this matter.)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 20, 2011, 10:33:44 AM
Wow!  I don't know how I got taken off the notification, but this thread has grown and I didn't get to read it until today.  If I had, I would have made mention that the "feud" between AP and GDA was out of place.  Personally, that anecdote about Tatiana "kicking" Buxhoeveden under the table always seemed a little "contrived " to me.  These young women were brought up to know just who they were and I have always felt that Bux was playing with her memories.

I like to hear from Simon as I know that he actually lived near and saw Manahan and Anna Anderson.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 20, 2011, 06:07:39 PM
[
There's nothing like inbreeding to make the sauce spicy. 
[/quote]

Wow. Actually, royals except for a line here or there are in general much less inbred than the general population of Europe. There's some good research on this if you're actually interested in that topic.

I know that Alexandra was very intense, but I don't think she was ever delusional especially in a clinical sense (as in thinking anyone had sex with Christ). As a very religious person, she thought that swimming in Sarov would help to bless her efforts to become pregnant with a son, and many people of faith do similar things. Just because we don't share in her faith is no cause to cast aspersions on her sanity or ridicule her or her faith. I think she was quite clear that Nicki was the father of her children.

I know of no evidence that Nicholas believed in "magic combs" or that his wife believed in soothsayers. There was actually a tradition of natural healing in Siberia and Rasputin's methods with the Tsesarevich appear to be remarkably similar to that tradition. Perhaps you've never been up for days at a time with a sick child. I have, and I would not be too hard on any parent who was comforted by a person who prayed for my child - and whose prayers appeared to be effective. I am disappointed that the desperation many of us feel at that time would be considered mentally unbalanced, but you are of course welcome to your opinion!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 20, 2011, 08:02:43 PM
 
Quote
Perhaps you've never been up for days at a time with a sick child. I have, and I would not be too hard on any parent who was comforted by a person who prayed for my child

I agree.  Poor Alexandra was a desparate mother with a sick child, a child that medical science was unable to help.  At Spala, the doctors were all but saying start digging the grave.  Alix writes to Rasputin and he says Alexei will not die.  And, Alexei recovers.  However, he did it, Rasputin did help him.  You can't blame Alix for embracing Rasputin.  He could help her son, something that the doctors couldn't.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 20, 2011, 09:34:33 PM

Wow. Actually, royals except for a line here or there are in general much less inbred than the general population of Europe. There's some good research on this if you're actually interested in that topic.


Ah, Lisa.  I see I've been long enough absent that you've forgotten that I sometimes like to write with my tongue in my cheek.



I know that Alexandra was very intense, but I don't think she was ever delusional especially in a clinical sense . . . .

I know of no evidence that Nicholas believed in "magic combs" or that his wife believed in soothsayers.

Actually, there is evidence in the form of a letter from Stavka to his wife that Nicholas combed his hair with a comb Rasputin blessed before he went in to meetings with his advisors . . . or at least said he did.  It's certainly possible that he did not actually do this but instead only wrote the letter to humor his wife.  But that wife had been vested by him -- against strong advice -- with responsibility for receiving reports from ministers on his behalf during a time of national peril.  Either way, it's not the best reflection on his powers of reasoning.

I think Alexandra went beyond intensity.  Dr. Botkin himself commented that the empress was "not entirely normal" which, given the understatement such a topic about such a personage would probably induce in him, probably says quite a lot.  I understand a troubled parent's seeking solace in religion and those in pastoral roles.  However, there are signs that Alexandra's faith went beyond zeal into the realm of religious hysteria:  her obsession with icons, her compulsive attendance of religious services, her exaggerated embrace of the rites of Orthodoxy after a more sober religious upbringing, her seeing the punishing hand of God in her son's hemophilia.

There was a discussion long ago on this forum about the medicines Nicholas and Alexandra were both using by the time of WWI -- medicines which apparently contained cocaine.  When one looks at both their conducts in the waning months of the monarchy, one does see symptoms which, if not dispositive of such drug use, certainly are consistent with it.  For instance, at the time delivery of food and fuel into St. Petersburg was breaking down in the winter of 1916-17, Nicholas was writing letters about taking long walks in the countryside outside Mogilev, wandering into empty churches for long reveries, saying that it was good to not be having to worry about things or being bothered by meetings with his counselors.  Some of this correspondence was just a few weeks before his capital descended into chaos and the revolution broke over his head.  There just seemed to be a listlessness and detachment to his behavior at this critical juncture that is hard to explain short of drug use.

In fact, Romanovs who tried to spur Nicholas and Alexandra into awareness of what was happening in the final days came away rebuffed and corresponding with each other that both husband and wife seemed resigned that the will of God was simply playing itself out.

_____________________

Sorry for straying off topic again.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 21, 2011, 02:51:02 PM
I have forgotten how your tongue can get stuck so firmly in your cheek, Tsarfan.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 21, 2011, 11:37:29 PM
Quote
There was a discussion long ago on this forum about the medicines Nicholas and Alexandra were both using by the time of WWI -- medicines which apparently contained cocaine.  When one looks at both their conducts in the waning months of the monarchy, one does see symptoms which, if not dispositive of such drug use, certainly are consistent with it.  For instance, at the time delivery of food and fuel into St. Petersburg was breaking down in the winter of 1916-17, Nicholas was writing letters about taking long walks in the countryside outside Mogilev, wandering into empty churches for long reveries, saying that it was good to not be having to worry about things or being bothered by meetings with his counselors.  Some of this correspondence was just a few weeks before his capital descended into chaos and the revolution broke over his head.  There just seemed to be a listlessness and detachment to his behavior at this critical juncture that is hard to explain short of drug use.

Well, they didn't really understand the bad effects of drugs like that back then.  I heard Sigmund Freud used from time to time.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 22, 2011, 09:15:53 AM
Resurrection of the Romanovs truly has nothing to do with Alexandra and her health problems.  I know that we got here by way of Anna Vyubova and by way of Anna we got to Rasputin, but that is not the point of this thread.

Very simply, those who kept Anna from Franceska thought that her connection to Rasputin would taint her testimony and/or taint the recognition (or non recognition) process.

Either way, lets get back to the topic.



Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 22, 2011, 07:35:37 PM
I see AA's tombstone reads "Anastasia Manahan".  I wonder if anyone wanted to change that once her true identity was finally revealed.  Also, her birth date is wrong, of course, she was five years older than her claimed age (she was 87, not 82, when she died).
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on January 22, 2011, 09:40:18 PM
I see AA's tombstone reads "Anastasia Manahan".  I wonder if anyone wanted to change that once her true identity was finally revealed.  Also, her birth date is wrong, of course, she was five years older than her claimed age (she was 87, not 82, when she died).

It also says 'H.I.H.' on it.

Received notice that the copy I ordered for the library has been shipped. As the cataloger, I will, of course, have first dibs.  ;)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 22, 2011, 11:11:41 PM
Quote
It also says 'H.I.H.' on it

Well, that should be removed.  This woman was never royality.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kransnoeselo on January 22, 2011, 11:26:39 PM
Quote
It also says 'H.I.H.' on it

Well, that should be removed.  This woman was never royality.

True or not, I think that one should be able to have whatever they want on their own tombstone.  That being said, I have to publicly commend Greg and Penny for the incredible amount of time and research they put into this work.  Thanks to their insights readers (for the first time) can see a very different side of Anna Anderson, a much more human and realistic portrayal.  I greatly appreciate their grace when dealing with her. She was a very complex individual who many people loved, even if she drove them to madness with her finicky, erratic and irritating ways. They treat her, accurately, as a wounded and mentally fragile person who struggled to escape a horrible past and to create a new life for herself.  This is the definitive book on Anderson and I applaud them for am amazing work.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 22, 2011, 11:45:22 PM
Was Jack Manahan buried with her when he died in 1990?
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 23, 2011, 12:14:26 AM
Jack was buried in Charlottesville as far as I recall, though I could be wrong-they had to jump through all kinds of legal and royal hoops to get AA's ashes interred at Seeon in 1984, taking depositions and battling surviving Leuchtenbergs by mail (who though they no longer owned it had reserved burial rights in the small cemetery attached to the Church of St. Walburg), so I am pretty sure after this Jack would not have ended up there.

As for the name on the memorial stone: like it or not, it's her legal name-recognized as such by the Commonwealth of Virginia when she dead-that's how permits to carry her ashes out of the US were listed and to allow them into Germany were listed as well. So she's Anastasia Manahan. As for the HIH and the dates, I don't think anyone actually cares or is left to pay the money needed to correct this-everyone knows-and people still come to Seeon to see her grave specifically, so I doubt they want to fool round with it
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 23, 2011, 01:16:56 AM
Quote
Jack was buried in Charlottesville as far as I recall, though I could be wrong-they had to jump through all kinds of legal and royal hoops to get AA's ashes interred at Seeon in 1984, taking depositions and battling surviving Leuchtenbergs by mail (who though they no longer owned it had reserved burial rights in the small cemetery attached to the Church of St. Walburg), so I am pretty sure after this Jack would not have ended up there

Kind of sad, it seems he really loved her, or at least he gave her company and security in her final years.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: rgt9w on January 23, 2011, 07:22:43 AM
Jack Manahan is buried in the University of Virginia cemetery. I assume he chose to be buried there since he was a former faculty member. Interestingly, the tombstone has both Jack and Anna listed, but she is listed as H.I.H. Anastasia Nikolaevna. I checked with UVA and their records show that there was only a memorial service for Anna Manahan. According to their records, none of her ashes were ever interred in the UVA cemetery.

I have always thought the UVA tombstone was strange since Anna Manahan died before Jack. If anyone has any other information about it I would be interested.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: rgt9w on January 23, 2011, 08:06:52 AM
I found this photograph of Jack's tombstone on the web. I have to correct myself from my earlier post, Anna's section reads "HIH Anastasia of Russia", not "Anastasia Nikolaevna"

If you click see full size image towards the top, you can see the full image better:

http://www.google.com/imgres?imgurl=http://www.readthehook.com/blog/wp-content/uploads/2009/02/news-anastasiagrave-med.jpg&imgrefurl=http://www.readthehook.com/blog/index.php/2009/02/14/annas-versary-anastasia-manahan-recalled-25-years-after-death/&usg=__8faTWexmpR_TrIEeHRRB_y8kKuM=&h=675&w=900&sz=298&hl=en&start=80&zoom=1&tbnid=iqH6EAi86qiTpM:&tbnh=110&tbnw=146&ei=pjQ8TbbyI4zVgAfngsW-CA&prev=/images%3Fq%3Danna%2Banderson%2Bmanahan%26start%3D60%26hl%3Den%26safe%3Dactive%26sa%3DN%26gbv%3D2%26tbs%3Disch:1&itbs=1
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: MademoiselleAndrea on January 23, 2011, 11:08:18 AM
It also says 'H.I.H.' on it.
WHAT!?!? That absolutely must be removed!  :o ::)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 23, 2011, 12:52:29 PM
I must be crazy, for the gravesite I remember of her at Seeon Castle, was a simple thombstone with the name "Anastasia Manahan" and the data "1901-1984". Of course, she was not Anstasia and was not linked to any Royal, but the gravesite doesn't said she was Grand Duchess Anastasia, so it could keep the name she choose to live without the "Romanov" adding. Manahan was her husband last name, so she can use it.

What I think it must be removed is the date of her birth, since she was not born in 1901, but in 1896. Oh...and the Orthodox Cross who is seen at the gravesite, must also be removed, since AA was not an Orthodox believer. She was born as a Catholic, she wouldn't know a great deal about Orthodox Faith, and she emphatized too much with antroposophist values . In any case, she was not an Orthodox. No reason to keep this Cross there...
 
   Now, a question. Under wich name did she marry Jack Manahan? Anna Anderson? Anna Tchaikowsky? Anastasia Nikolaievna Romanova? In this last case, I think that sadly, the marriage was invalid, for she married under the name of a dead person ...

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: rgt9w on January 23, 2011, 01:37:03 PM
RealAnastasia,

The previous picture was Jack Manahan's grave in the University of Virginia Cemetery.

This is a photo of the gravesite at Castle Seeon where her ashes were buried:

http://3.bp.blogspot.com/_sLsMjHL9bRA/Sz3zboFpOaI/AAAAAAAAATA/OaJNe-mF_rI/s320/grave.JPG
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 23, 2011, 01:46:12 PM
There. Here you go: this is her cenotaphe (not her gravesite; her ashes were scattered near the spot we are showing at the pic):

(http://img708.imageshack.us/img708/3662/andersonmanahan.jpg)


RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 23, 2011, 01:48:46 PM
How funny...While you were sending the link, I just posted the same photo you did! :D

Yes; I know that your posting showed Jack's gravesite. I've already seen it.

But as I've already said AA cenotaphe only reads: "Anastasia Manahan". I don't see any "H.I.H" on it...

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: rgt9w on January 23, 2011, 01:57:38 PM
Thanks for posting the pic!

To my knowledge, the Castle Seeon cenotaph does not have "HIH" on it, only the tombstone in Charlottesville.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Robert_Hall on January 23, 2011, 03:25:44 PM
Eastern Rite Catholics use the  so-called "Orthodox" cross. And, being from Poland, she could very well have been Eastern Rite.  I went to a Polish school in D.C. and we used both. It is just a form, not restricted to any denomination.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 24, 2011, 09:32:21 AM
I thought that I read somewhere, maybe Kurth's book, that when Anna married Jack, the marriage license listed her as Anastasia Nikolaevna Romanova.

I am pretty sure that the fake Alexei - Michael Goleniewski - used Alexei Nikolaevich as his name when he married.

Marriage under a false name is a crime, but somehow except to us, it doesn't seem to matter too much in either case.

I don't think that a gravestone is a legal document in any fashion, so what is put on one is not open to prosecution.  I don't imagine that anyone from the legal descendants even cares enough to spend the money running around the world correcting grave stones.

I have said before that I do a lot of genealogy research.  If any of you did this kind of research you would find that even people with the best of intentions can seriously mess up a family tree.  I found someone who co-opted my 9th great grandfather as her own and has him married to the wrong person and living in the wrong state, just because (in my opinion) she thought that the dates looked good and perhaps the name fit her family tales. (Or maybe he was a bigamist??)  I have found family trees where the children are shown to have been born before the father was even born, but that doesn't stop the owners of these trees from believing that they have found the truth.  I sometimes write to the owners and ask them how they think that these trees can be correct when the dates are so obviously wrong.  I usually get no answer.

So gravestones don't seem to be very important, although people do go and visit and take pictures of them.  False and misleading information will always be out there and subject to interpretation.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 24, 2011, 09:39:39 AM
I don't think marrying under a false name actually invalidates the marriage, in Britain at any rate. What's important is that they go through the proper ceremony, are of age and have the mental capacity, are consenting and free to marry. Some time ago there was a curious case where a teenager on work experience actually conducted a church wedding (the figure arrived late and the lad just took over!). The opinion of the academics the newspapers consulted was that the wedding was probably valid, as it's very difficult in law to hold a marriage invalid.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 24, 2011, 10:03:39 AM
I thought that marriage under a false name would be crime.  

It seems that "you marry the individual" not the name.  

However:  It could be considered fraud and grounds for a divorce.  Fraud is a crime.  

The whole things seems to go 'round in circles.

After research, if also depends on what the person is trying to hide by changing the name, but not changing it legally.

I also wonder, since everyone has to show proof of identity when applying for a marriage license, how anyone could marry legally and use a false name?

But being buried under a false name, is something else.  Unless one is applying for Government Burial Benefits is the US, no one asks for proof of identity of the deceased except for the death certificate.  Death certificates often do not have correct information because the doctor who signs the form doesn't know or the person who is taking claim of the body doesn't know or doesn't give the correct information.  Many people are buried by those who are not related to them and therefore the person who is making the arrangements doesn't know.

When my father's cousin died, it was listed that he had no living relatives.  That was very wrong as he had many second and third cousins.  When his death was listed in the newspaper, many of us called the funeral home to let them know that we were out there, but just had lost touch with him.  The funeral director was almost overwhelmed by the number of calls.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 24, 2011, 11:14:27 AM
Yes, Alixz, you are right. When my great-granny died, one of his sons, put her name at the gravesite as "Pepita Canut de Monteavaro", and of course his real name was not Pepita (she was born in Spain), but Josefina...Since his son called her with this common Spanish nickname she went to her last house under a ridicoulous  name...And since my uncle is a communist he added a communist star beside her mother's name. My poor great-granny was not a communist and she is buried as one because his own son beliefs. Very sick, indeed.

The trouble with "the name issue", in AA's case is that Jack was marrying the person she was not. As you've said, a fraud was involved there, and I think Mr. Manahan was never aware of it. He truly believed that his wife was Anastasia...

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 24, 2011, 11:18:38 AM
The name AA used to marry Jack was "Anna Anderson, born Romanov. Her father is "Nicholas Romanov" and her mother ,Alexandra of Hesse Darmstatd. The document  also said that she was raised by an "Institutrice".

I took the data from Blair Lovell's book.

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Robert_Hall on January 24, 2011, 12:35:51 PM
I think you can pretty much put anything you want on a grave stone or memorial stone, whatever. Here in SF, we have the SF Character Emperor Norton, a well loved figure of the  Barbary Coast days. Buried as such. And  entertainment celebrities are often  buried with their professional names rather than their real names.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 24, 2011, 12:41:27 PM
I appreciate the technical distinction made by the posters: "RealAnastasia", # 309 and "rgt9w, # 311, on this thread, as to the use of the word "cenotaph."  As I understand it, "cenotaph" denotes an "empty tomb," which is apparently (?) the case with the "Anastasia" site at Seeon. One of the posters says that her "ashes were scattered near the spot" (of the cenotaph/plaque). Interesting---I don't believe that I had heard of the scattering of her ashes as opposed to physical burial of a container holding her total cremated remains. Page # 255 of the King and Wilson book reads (emphasis mine), " ....decorating the wall above the space where the BOX OF ASHES HAD BEEN INTERRED, was a memorial plaque......'    Regardless, I do not foresee the remains being removed (if they were "scattered", COULD be a bit of an impossibility!); they were legally placed there with the prior knowledge and permission of the concerned parties.  Macht's nicht!  And, yes, the site (barring any local restrictions) will certainly have the potential to draw the curious to a visit!  Regards,  AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 24, 2011, 09:51:21 PM
I also believed AA's ashes were buried at Seeon, but after doing some research on the net, I discovered that most of the notices about her would speak of her cremated remains being "...scattered..." close to the place of this plaque.

I agree about the potential appeal to tourist this gravesite could have. AA was not Anastasia, but she was the woman who claimed to be she for six decades . She is a character by herself, even if she was not a Romanov.

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 24, 2011, 11:45:27 PM
Her ashes were in a small box/container and placed into the ground, not scattered-we talked to several people who had been present at the ceremony and remember distinctly Jack handing the box over and watching it placed into the hole.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 25, 2011, 01:13:10 AM
Yeah, I read that part, and that Jack held on to the ashes until all the details were worked out.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: aleksandr pavlovich on January 25, 2011, 06:40:37 AM
Re Reply #331, Ashes of AA buried "whole", not scattered:  Thanks, Greg for the clarification, thus I understand that the "cremains" were a burial as a whole unit below/or very near the wall memorial marker, based on eyewittnesses at the time/site.    Regards,  AP.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 26, 2011, 10:12:33 PM
Thanks for the insight. So it means that her ashes are still there?

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 26, 2011, 11:11:16 PM
Yeah, they no doubt are.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: toscany on January 28, 2011, 01:26:25 PM
Although Greg King and Penny Wilson say that Anna Anderson was Franziska Schanzkowska, circumstantial evidence supporting that Anna Anderson was Anastasia is immense. It is very sad, and at the same time interesting they switched positions. It is a shame that Greg King and Penny Wilson only reviewed the Hesse archives. Many people know that after the Hamburg Court declared a stalemate, the lawyer hired by the Hesse family, Dr. von Berenberg-Gosler, went to work for them at Schloss Wolfsgarten, along with a historian and a librarian. Gosler spent several years cleaning and weeding through what information they would make "available" to the public. If they would have only searched the many other archives available in Europe, King and Wilson would have discovered the true fate of the Imperial Family, and why Anastasia was punished and rejected by some her own relatives. They are very far from the truth. Fortunately, soon everything is going to be uncovered. Yes, no more lies and misinformation! Definitely, the "final word" on this story is about to be revealed.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 28, 2011, 01:58:33 PM
In the view of this forum, the "final word" on the story has already been revealed.

I am asking that this topic is not hijacked to become another platform for alternate theories or half/truths.

I am asking a nicely as possible.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: toscany on January 28, 2011, 02:01:22 PM
In the view of this forum, the "final word" on the story has already been revealed.

I am asking that this topic is not hijacked to become another platform for alternate theories or half/truths.

I am asking a nicely as possible.

Agreed. And it is a promise!  No conspiracy theory will be mentioned.  There is no need...
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 28, 2011, 04:18:12 PM
Quote
Fortunately, soon everything is going to be uncovered. Yes, no more lies and misinformation! Definitely, the "final word" on this story is about to be revealed.

And I have this bridge in Brooklyn for sale...
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 28, 2011, 04:46:32 PM
And I HAVE to say that this absurd notion that we ONLY consulted the Hessian archives is, frankly, a word I can't say here. Check the sources-we worked in the Hamburg archives with the trial documents; with private archives; with archives from Peter Kurth; from Ian Lilburn (the last 2 AA supporters) and any number of others.

Saying we worked only with a pilfered and selective Staatsarchiv collection in Darmstadt is rot, pure and simple-but par for the course for those who don't bother to actually read the book and look at the sources
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 29, 2011, 09:39:13 AM
Greg - Thank you.  It is true that anyone who wants to comment on the sources for "Resurrection of the Romanovs" should read the sources pages.

As is my job here, I have been trying very delicately to defuse this most possible hijacking of this thread on your book.

I do want to ask all to follow the rules of the forum.  If you don't listen to me, then I am sure you will hear from the Forum Administrator.

To all posters - please no snarking.  To all posters - please observe the rules.

I know for a fact that if someone begins to post things that FA had forbidden, they will be removed.  FA owns the forum.  FA sets the rules.

I also know that FA has set up a "Myths" section where he allows those who still do not believe to post their thoughts and outlooks.

I am probably too soft at times and I do try to be as gentle as possible when rebuking someone.  I even use PMs before I post for the public so I have been attending to this current disruption, but I ask again that "snarking" stops.  

Let's all be like President Obama and ask for a less vitriolic way of expressing ourselves.

But above all - please follow the rules! 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 29, 2011, 10:05:58 AM
Although Greg King and Penny Wilson say that Anna Anderson was Franziska Schanzkowska, circumstantial evidence supporting that Anna Anderson was Anastasia is immense. It is very sad, and at the same time interesting they switched positions. It is a shame that Greg King and Penny Wilson only reviewed the Hesse archives. Many people know that after the Hamburg Court declared a stalemate, the lawyer hired by the Hesse family, Dr. von Berenberg-Gosler, went to work for them at Schloss Wolfsgarten, along with a historian and a librarian. Gosler spent several years cleaning and weeding through what information they would make "available" to the public. If they would have only searched the many other archives available in Europe, King and Wilson would have discovered the true fate of the Imperial Family, and why Anastasia was punished and rejected by some her own relatives. They are very far from the truth. Fortunately, soon everything is going to be uncovered. Yes, no more lies and misinformation! Definitely, the "final word" on this story is about to be revealed.

Oh, its YOU again. The one in Georgia who has been making these same allegations for years. Umm, its been what three? four years? since you starting saying "the final word is ABOUT to be revealed"? Well, still nothing "revealed". DUH.

Direction to all mods: This poster is not allowed to make any further statements ANYWHERE IN THE FORUM to this same effect UNLESS accompanied by the specific documentation and source citations to support them. Any such posts are to be summarily removed without further notice.  Unless and until this happens, this line of conversation is over. Period.

FA
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Ilana on January 29, 2011, 11:01:34 AM
Oh, darn, wanted to hear the "final word".  Just kidding, guys!!!!!!

Greg, Penny, I have finished the book and want to let you know that I am in awe of your research and conclusions. To plow through all the trial documents is, I feel, the Olympics of historical research.

Well done.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on January 29, 2011, 11:54:38 AM
Here is a quote from Greg King back in July on the FS Pt 7 thread regarding the then upcoming book:

"While we cannot really discuss the contents of the book at this point, I do want to stick my neck out a bit and say this: I wouldn't be too hard on the people who still believe AA was Anastasia or who harbor doubts-not because myself or Penny have any doubt but that she was Franziska-but because I suspect that many people are exactly as we were: filled with unanswered questions, and wanting to see evidence reconciled to the DNA results. It took us ten years to actually go through all of the documentation, most of which has never been published, to understand that what we all believed to be true about the AA case-about the evidence in her favor-was often lacking. We, like everyone else, had read around both sides of the case, but the overwhelming bulk of evidence was always suggestive of AA having been Anastasia; only after going back to original source material did we find that much of this evidence in her favor does not hold up. It was very important for us to answer all of the questions we had-just as I suspect that those who still believe AA was Anastasia want to see their questions answered. Hopefully we can do that in this book. It is meant with no disrespect when I say that I believe that most of them are-as we were-wanting only these answers. Without them, the case remains an intriguing enigma of "How did AA know X, Y, or Z?" The problem, as we found, is that the record of AA's case-the evidence in AA's favor-was grossly distorted back in the 1920s and these errors have been unknowingly perpetuated because no real investigation has taken place since the 1994 DNA. My point is just this: Don't be too hard on those who still believe-a decade ago Penny and myself were amongst their ranks, wanting answers; we just happen to have been fortunate to have worked hard at finding them. I think we will find that, once people can see what we have uncovered and the answers we found, that many will come to the same conclusion as we did regarding the absolute certainty that AA was Franziska. It has less to do with ignoring the DNA than it does with reconciling the evidence, which I hope we have done."
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 29, 2011, 08:40:18 PM
Although Greg King and Penny Wilson say that Anna Anderson was Franziska Schanzkowska, circumstantial evidence supporting that Anna Anderson was Anastasia is immense. It is very sad, and at the same time interesting they switched positions. It is a shame that Greg King and Penny Wilson only reviewed the Hesse archives. Many people know that after the Hamburg Court declared a stalemate, the lawyer hired by the Hesse family, Dr. von Berenberg-Gosler, went to work for them at Schloss Wolfsgarten, along with a historian and a librarian. Gosler spent several years cleaning and weeding through what information they would make "available" to the public. If they would have only searched the many other archives available in Europe, King and Wilson would have discovered the true fate of the Imperial Family, and why Anastasia was punished and rejected by some her own relatives. They are very far from the truth. Fortunately, soon everything is going to be uncovered. Yes, no more lies and misinformation! Definitely, the "final word" on this story is about to be revealed.

This poster put up this identical -- and highly inaccurate -- post NINE times as comments on all eight book reviews of Resurrection on Amazon.com.  He definitely has an agenda going.  And it's a rather bizarre one.  The loonies are starting to march on the next round of their campaign to keep the Anderson-was-Anastasia flame alive.

Alixz is right.  A debate with the likes of this poster does not belong here.  Readers who want to follow it should look at the comments on the book reviews at Amazon.com.

It's simply not possible to have a reasoned discussion, either pro or con on this book, with people who deliberately lie about the archival sources King and Wilson used and who are selling some snake oil about a soon-to-be-revealed shocker about the "true fate" of the imperial family.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on January 29, 2011, 09:47:53 PM
I read one of the one-star reviews. The author cites various typos and misspellings as proof the book is wretched. One she cites is:

"King and Wilson maintain that - contrary to what the claimant told Felix Dassel - the Tsar had the image of a dragon tattooed onto his right arm on a visit to Japan in 1891 - so large and colourful that it took seven hours to complete. [page 168]. King &Wilson's reference, note 30, [page 356] comes from Nicholas's diary in the GARF archive. The authors' are not playing fair with us here, since we don't access to this source, perhaps they should have reproduced in their book the entire page mentioned. Nor have I seen any mention of such a significant tattoo in any of the literature about the Tsarevich before he became Tsar. The diary was never published in book form.

In fact tattooing was banned in Japan from 1878 to 1948. It's not as if the Tsarevich was a student backpacking round Japan on his gap year. He was on an official visit. There's more: In Massie's "Nicholas & Alexandra" [Gollancz, London 1968] there is a photograph of the Tsar holding a tennis racket, with his right sleeve rolled up, and there is no large dragon tattoo visible. Nor does any other writer I've ever read mention this tattoo. I now fully expect to see the same photograph on some anti-Anna Anderson website soon with a large dragon tattoo added, plus a hitherto-unknown reference to it in some obscure memoirs. "

It is actually common knowledge of royal tattoos and I have several articles on the subject myself, including (finally!) info on the colorful dragon tattoo that George V had. Tattoos weren't banned for foreigners but, really, using that to debunk the book? The review author, LittleNell was accused in the comments (46 of them!) of being Peter Kurth. This was denied. I also recognized the poster ChatNoir who used to post here and who says they know Little Nell. It's quite the little discussion there. A lot of it dealing just with the tattoo issue since their complaint is so easily dealt with as to engender disbelief. The AP has already been cited  by Little Nell:

"There seems to be a misguided belief that the Alexander Palace Time Machine must be the arbiter of
all discussions about the Romanovs in general and Anastasia in particular, even when the blog is on Amazon.com.
I cannot, and indeed will not, subscribe to this theory, which is why I have never joined the APTM blogs. I know the
Alexander Palace Time Machine has done fine work in making available books on-line which have long been out
of print, but why should I bother to correct the blatant stupidities I see expressed there by bloggers whose
experience with the claimant's case goes no further than an animation movie and a Time Magazine report
about bones found near Ekaterinburg."

Not a high opinion of us!  :)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 29, 2011, 10:27:55 PM
Oh, you should read all the comments under both the negative reviews.  It's a real circus.  

The Little Nell character who wrote the long review had earlier posted a briefer review followed by many comments in which he (note the "he") stated categorically that Anna Anderson was Anastasia and that there was little point in further discussion.  Nevertheless, he then proceeded to take down that review and post a much longer one.

In the comments that disappeared with that first review, he also stated that he was going to demonstrate in his new review that King and Wilson were so wrong on so many details that they were certainly wrong about Anderson's being Schanzkowska.  Then he proceeded to put up a review that had a higher error rate than anything he was claiming about ROTR's error rate.

He further claimed he was "not going to refute the DNA evidence".  He has refused, though, to reconcile those two mutually-exclusive statements.

He also stated in the removed comments he would not examine the DNA evidence, because he did not understand the statistical calculations behind it.  In other words, he rejects all evidence, including scientific evidence, if he cannot personally understand the technical aspects of it.  By that logic, I doubt if there's much in modern life -- from GPS systems to PET scans -- that he accepts as valid indicators of what they purport to determine.

It's no wonder that Anna Anderson managed to convince him that she was Anastasia.  She could probably have convinced him that she was Nicholas II if she had had half a mind.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 30, 2011, 01:01:21 AM
I read those reviews.  The Flat Earth Society is alive and well, no matter what evidence you can show them.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 30, 2011, 08:10:54 AM
I know that there is posting on the Nicholas II thread about a dragon tattoo.

I am familiar with the photo that GDE is referring to and I believe it is already posted on the Nicholas II site.

Unfortunately, when I was new at moderating, I "spring cleaned" some threads and combined topics that I thought should be combined.  This made finding some of the previous posting difficult. I have tried to separate that information, but I (for some reason) find it hard to use the "separate" feature that is available to the moderators.  I have apologized in the past for confusing the issue and I do so again.

However, I am going to find out where that information is and at least give everyone a link to look at it themselves.

I personally thought that there was evidence of that dragon tattoo on his arm.  That does not mean that I believe that Anna Anderson was Anastasia, it just means that their might have been a tattoo and that someone told her about it as she was given so much other information that made her seem to be "well informed" on things that only she should know.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 30, 2011, 09:07:17 AM
Here is the post from the Nicholas II thread.  I couldn't bring over the pictures of Nicholas's arm, but they are on pages 11-13 and more.


"This is the first time I've read this thread.

I am interested in Nicholas II's tattoo.

Can someone provide the full photos from which the photos below are a part.

Thanks.

AGRBear


Quote from: Lisa on February 17, 2006, 09:59:51 AM
Nicholas definitely had a tatoo:

Why we could not see it properly? Here my hypothesis
1: here remove it and had just a scar, so it is less visible
2: in the 19 and 20th century, because of the chemical process of the photography, some of the colors are changed in the photo. For example, blue looks like white and red and yellow look like black. So IF his tattoo was blue, we could not see it properly.
3: the person who developed the photograph retouched the negative in order to hide Nicholas' tattoo...

Pictures of Nicholas' right arm:
      
Here I pushed  the contrast and you can see clearly  a tattoo!
  

Just to compare, here is the George V's dragon:
http://www.vanishingtattoo.com/tattoo/celeb-georgehtm.htm
  
 
 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kransnoeselo on January 30, 2011, 09:49:42 AM

I personally thought that there was evidence of that dragon tattoo on his arm.  That does not mean that I believe that Anna Anderson was Anastasia, it just means that their might have been a tattoo and that someone told her about it as she was given so much other information that made her seem to be "well informed" on things that only she should know.

Thank you Alixz for finding that post. I too knew it was somewhere but could not track it down.  

Yes, The Tsar did have a tattoo, that he had gotten while in Japan. It was large and colorful on his right arm.  

 Felix Dassel a Russian officer who had been wounded in WWI and stayed in GD Marie and Anastasia's hospital in Tsarskoe Selo, had made mention that the Tsar had a tattoo,upon hearing this Anna Anderson adamantly denied its existence. In several of the pro-Anderson biographies it was assumed incorrectly that the Tsar had no tattoo and therefore Anderson was right.  Yet not only was she wrong, the real Anastasia would have not only have seen the tattoo but couldn't have forgotten it due to it's size.

And here is a photo of the Tsar with his arm exposed showing the tattoo and Anastasia standing immediately behind him.

http://i87.photobucket.com/albums/k136/tsarskoe/tattoo4.jpg

http://i87.photobucket.com/albums/k136/tsarskoe/tattoo3.jpg

Compare to the Dragon in the previous post. It is faint and blurry but the outline is the same.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 30, 2011, 11:45:45 AM
'This poster put up this identical -- and highly inaccurate -- post NINE times as comments on all eight book reviews of Resurrection on Amazon.com.'

Interestingly, I got my copy of Resurrection from amazon, and have just come home from a weekend away to find a message from amazon asking me to review it. I shall.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 30, 2011, 11:53:47 AM
I have no fear about pointing out the gorilla in the corner. It is indeed sad that Peter Kurth is hiding behind the "Little Nell" name on Amazon to try to trash the book. Even worse is his refusal to read and comment on the manuscript before publishing and now come out and make these allegations.

The most telling thing to me about the lunacy on the Amazon reviews is that every single person who supports the book and Penny and Greg uses THEIR OWN REAL NAME. The ones who want to trash it hide in darkness with made up pseudonyms ("little nell" and "Chat Noir") because they do not have the courage and conviction to speak with their real names. That alone should tell you about their agenda and mind set.

Pathetic.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on January 30, 2011, 12:15:01 PM
This whole issue of the tattoo is much the point of the middle section of Greg and Penny's book about how convoluted information became with the AA debacle. I can remember early on with the APTM that someone said I made a mistake about the Palace because AA had said something to the contrary. Turned out I was correct, but how she muddled the mix!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 30, 2011, 12:29:24 PM
'The most telling thing to me about the lunacy on the Amazon reviews is that every single person who supports the book and Penny and Greg uses THEIR OWN REAL NAME. The ones who want to trash it hide in darkness with made up pseudonyms ("little nell" and "Chat Noir") because they do not have the courage and conviction to speak with their real names. That alone should tell you about their agenda and mind set.'

Look out for my review under my own name!

Ann Lyon
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on January 30, 2011, 02:11:32 PM
Although Greg King and Penny Wilson say that Anna Anderson was Franziska Schanzkowska, circumstantial evidence supporting that Anna Anderson was Anastasia is immense. It is very sad, and at the same time interesting they switched positions. It is a shame that Greg King and Penny Wilson only reviewed the Hesse archives. Many people know that after the Hamburg Court declared a stalemate, the lawyer hired by the Hesse family, Dr. von Berenberg-Gosler, went to work for them at Schloss Wolfsgarten, along with a historian and a librarian. Gosler spent several years cleaning and weeding through what information they would make "available" to the public. If they would have only searched the many other archives available in Europe, King and Wilson would have discovered the true fate of the Imperial Family, and why Anastasia was punished and rejected by some her own relatives. They are very far from the truth. Fortunately, soon everything is going to be uncovered. Yes, no more lies and misinformation! Definitely, the "final word" on this story is about to be revealed.

As well as being in all the comments on reviews of the book this now the 2 star review itself.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 30, 2011, 02:14:58 PM
HarryB just put up a comment under the review saying it was going to reveal "a 'great truth' that will be published internationally in due time of process."

The Believers must be very, very proud of the company they attract.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 30, 2011, 03:50:46 PM
HarryB is the same Harry Binkow who posted that same trash, the guy from Athens Georgia, on the previous page.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on January 30, 2011, 04:01:45 PM
Nicholas definetly had a tatoo:

Why we could not see it properly? Here my hypothesis
1: here remove it and had just a scar, so it is less visible
2: in the 19 and 20th century, because of the chimical process of the photography, some of the colors are changed in the photo. For exemple, blue looks like white and red and yellow look like black. So IF his tatoo was blue, we could not see it properly.
3: the person who developp the photograph retouched the negative in order to hide Nicholas' tatoo...

Pictures of Nicholas' right arm:
(http://img139.imageshack.us/img139/4779/000440072wa.th.jpg) (http://img139.imageshack.us/my.php?image=000440072wa.jpg)  (http://img114.imageshack.us/img114/4369/000640136og.th.jpg) (http://img114.imageshack.us/my.php?image=000640136og.jpg)  (http://img114.imageshack.us/img114/5532/000640198cw.th.jpg) (http://img114.imageshack.us/my.php?image=000640198cw.jpg)  
Here I pushed  the contrast and you can see clearly  a tatoo!
(http://img114.imageshack.us/img114/8643/0006401919ew.th.jpg) (http://img114.imageshack.us/my.php?image=0006401919ew.jpg)  (http://img114.imageshack.us/img114/8229/00094004a3ci.th.jpg) (http://img114.imageshack.us/my.php?image=00094004a3ci.jpg)

Just to compare, here is the George V's dragon:(http://img125.imageshack.us/img125/429/tatouagegeorgev4sr.th.jpg) (http://img125.imageshack.us/my.php?image=tatouagegeorgev4sr.jpg)
http://www.vanishingtattoo.com/tattoo/celeb-georgehtm.htm


Here is the post from the Nicholas II thread.  I couldn't bring over the pictures of Nicholas's arm, but they are on pages 11-13 and more.


"This is the first time I've read this thread.

I am interested in Nicholas II's tattoo.

Can someone provide the full photos from which the photos below are a part.

Thanks.

AGRBear


Quote from: Lisa on February 17, 2006, 09:59:51 AM
Nicholas definitely had a tatoo:

Why we could not see it properly? Here my hypothesis
1: here remove it and had just a scar, so it is less visible
2: in the 19 and 20th century, because of the chemical process of the photography, some of the colors are changed in the photo. For example, blue looks like white and red and yellow look like black. So IF his tattoo was blue, we could not see it properly.
3: the person who developed the photograph retouched the negative in order to hide Nicholas' tattoo...

Pictures of Nicholas' right arm:
      
Here I pushed  the contrast and you can see clearly  a tattoo!
  

Just to compare, here is the George V's dragon:
http://www.vanishingtattoo.com/tattoo/celeb-georgehtm.htm
  





AGRBear, if I’m not mistaken I think these pictures come from Beinecke Albums, the last two links are not the one posted but they show Nicholas’ tatoo

http://brbl-images.library.yale.edu/ROMANOVIMG/size4/D0009/00094004.jpg
http://brbl-images.library.yale.edu/ROMANOVIMG/size4/D0006/00064013.jpg
http://brbl-images.library.yale.edu/ROMANOVIMG/size4/D0006/00064019.jpg
http://brbl-images.library.yale.edu/ROMANOVIMG/size4/D0004/00044007.jpg
http://brbl-images.library.yale.edu/ROMANOVIMG/size4/D0002/00024014.jpg


Thank you.

AGRBear
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Carolath Habsburg on January 30, 2011, 04:05:45 PM
Im reading those comments. For gods sake...(http://img831.imageshack.us/img831/6113/gallery63654401180.gif) (http://img831.imageshack.us/i/gallery63654401180.gif/)

 
 

Im waiting for get that book. A good friend of mine bought it and she s gonna borrow it me while im at the hospital (im giving birth in a coiple of weeks)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on January 30, 2011, 04:22:14 PM
I think worrying about people using their real name is silly.   No one here knows who I am,  and,  I intend to keep it this way.   And,  if I choose to voice my opinion over on Amazon, as I have here on AP,  I would continue to use my alias.  

LittleNell8 is not Peter Kurth.  I am friends with both even though we have different opinions as to AA being FS.  

Peter Kurth fully co-operated with Greg and Penny in their search for this book.  Greg and probably Penny will mention the help he gave them as this discussion continues here on AP.  

I find it quite offense for poster to degrade these three authors, who have always wanted to discover the truth about AA.  

Calling people names because you don't share their opinions is lacking respect.   If you don't agree,  say so,  give a source and ALWAYS be respectful.   As adults,  act like adult and give the younger generation examples of how to discuss a subject without showing your childish side.

[Bear climbs off her soap box].

Exit stage right.

AGRBear

'The most telling thing to me about the lunacy on the Amazon reviews is that every single person who supports the book and Penny and Greg uses THEIR OWN REAL NAME. The ones who want to trash it hide in darkness with made up pseudonyms ("little nell" and "Chat Noir") because they do not have the courage and conviction to speak with their real names. That alone should tell you about their agenda and mind set.'

Look out for my review under my own name!

Ann Lyon

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 30, 2011, 04:47:08 PM
Anyone who still believes AA was Anastasia seriously needs a reality check.  I just love when they mention this sinister international cabal that has tainted the DNA.  Of course, they never give a reason why this mythological cabal would do it.  Logic is something these people are immune to, it seems.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: historyfan on January 30, 2011, 08:38:08 PM
Sounds to me as though there are a lot of people turning over in a lot of graves right about now.  Good Lord.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 30, 2011, 10:48:27 PM
I have no fear about pointing out the gorilla in the corner. It is indeed sad that Peter Kurth is hiding behind the "Little Nell" name on Amazon to try to trash the book. Even worse is his refusal to read and comment on the manuscript before publishing and now come out and make these allegations.

The most telling thing to me about the lunacy on the Amazon reviews is that every single person who supports the book and Penny and Greg uses THEIR OWN REAL NAME. The ones who want to trash it hide in darkness with made up pseudonyms ("little nell" and "Chat Noir") because they do not have the courage and conviction to speak with their real names. That alone should tell you about their agenda and mind set.

Pathetic.

Good night, FA:

                                  Are you really SURE that "Little Nell" IS indeed Peter Kurth? I think it's out of his personality to act in such a vicious way. I think that Greg and Penny did an outstanding work demonstrating who AA really was (and I still find somewhat hard to accept it, not for my mind is closed to reasoning, but only for I believed in her claim for years) and that Peter would not be very bright if attacking them without showing any new document who could allow him to say his colleagues are wrong. If them two as researchers, found all this great amount of information , showing that AA was FS and not ANR, one must accept it, or at least try to find the same amount of documents to demonstrate the opposite. But Peter is a good researcher, an honest one, and would never attack Penny and Greg in such incivilizated way . When I believed that AA was ANR, I ws sincere, and didn't want to attack people who wouldn't share my opinion. In fact, I was saddened the way that pro-FS party (they were right, but this is not a reason to dismiss a sincere person who believes otherwise) treated me, Greg, Penny (back then, they were quite convinced about AA's claim legitimacy), Bear, Peter and some other AP Forums members. I'll be surprised if Peter acts the same way toward other researchers...This is not my friend Peter.

                                    Again, FA: Are you really sure that this "Little Nell" is indeed Peter Kurth? I doubt it.

                                     RealAnastasia.                                
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on January 31, 2011, 06:11:36 AM
Peter did indeed assist us when we were researching the book. It is also true that he declined several offers to read the manuscript prior to publication and offer comments or corrections, which of course was his right.

The fracas on Amazon is more amusing than anything else-clearly an instructive lesson in bizarre psychology
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 31, 2011, 06:31:13 AM

LittleNell8 is not Peter Kurth.  I am friends with both even though we have different opinions as to AA being FS . . . .  

Calling people names because you don't share their opinions is lacking respect.   If you don't agree,  say so,  give a source and ALWAYS be respectful.   As adults,  act like adult and give the younger generation examples of how to discuss a subject without showing your childish side.


Bear, what is your view of your friend Little Nell's referring on amazon to Resurrection as a "silly hoax"?  Is that your definition of "respect"?

Perhaps your friend Nell is posting on amazon on Peter's behalf.  But you -- and others -- really should read the comments on amazon to understand the case for Little Nell's identity.  She even uses the same affectation of British spellings that Kurth uses.  And there is considerably more.

You're going to make a serious mistake if you want to bring all this onto the AP forum.  But I suspect you will, anyway.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 31, 2011, 08:45:26 AM
I don't believe that this thread is the place to discuss other review of this very serious and well researched book.

Many who post here are historians and professionals and have access to the sources and many, like me, are just "talented" amateurs (if I do say so myself).

Everyone in the world is entitled to his/her own opinion.

FA, of course, owns the thread and has the right to post whatever her wants to.  The rest of us obey his rules.

The "prime directive",so to speak, is civility and respect for each other.  Please let us have that and stop the snarking and the back biting.

We have now got ROTR to replace FOTR as the subject of intense scrutiny and intense personal opinion.

Discussion of FOTR was banned in the not too distant past, lets not start all over again with ROTR!

Greg and Penney are talented researchers and writers.  Peter Kurth is entitled to his own opinions and has written his own works on the subject from his point of view and from the direction in which his research took him.

Just because there are some who wish to review ROTR on Amazon and disagree with the results that Greg and Penney published should not have anything to do with our discussion of the book and its merits (which I find are many - but then I as much as I wanted to be an Anna Anderson believer - I just could not be).

This AA as FS controversy has been going on here on the Forum and everywhere else in the world since before most of us were born.  But let's stick to Greg and Penny's wonderful book and not get sidetracked, yet again.

FA has given the moderators the right to delete any posts that do not conform to the rules of the forum.  I don't like to have to do that, but if we can't end this age old controversy over AA vs FA and who knew or didn't know or who is Chat Noir or Lil Nell (which doesn't at all matter in this thread) I will begin deleting!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 31, 2011, 08:55:26 AM
Actually, right now, I have a very important matter to deal with.

Griff Henninger, who is the author of the six continuing threads called "The Empress Alexandra Fights Back" has asked that all six threads be deleted.

Griff is ready to publish his first work on Alexandra and his publisher has asked that all of the material in the Empress Alexandra Fights Back be deleted from the forum.  It has to do with copyright infringement and other matters.

I have posted this on the Alexandra sub forum and as of now, I am prepared to delete that mass of work on Wednesday, February 2, 2011.

As much as I don't want to, it is Griff's request and, I guess, his need to have all of the research and notes taken down before his work goes into publication.

Jus thought you might like to know.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on January 31, 2011, 09:13:39 AM
Here is my review for Amazon.

5.0 out of 5 stars An Excellent Book, 31 Jan 2011
By A. E. Lyon "Ann" (Plymouth, England) - See all my reviews
(REAL NAME)                   

This review is from: The Resurrection of the Romanovs: Anastasia, Anna Anderson, and the World's Greatest Royal Mystery (Hardcover)
I first heard about Anna Anderson when I was 11. I was a sceptic then and a sceptic I remained, though there was a lurking doubt until the 1994 DNA tests proved her to be an imposter. However, what has always interested me is how it was that so many people, by no means all of them unintelligent or hopelessly romantic, believed her improbable claims. Greg King and Penny Wilson have provided convincing answers. First, until as late as 2007, when the final Romanov bodies were discovered, there was simply no definite proof that Anastasia had been murdered with the rest of the family. Second, Anna Anderson (as I continue to think of her), had had a good basic education and a remarkable memory for small details, either those this read in books and magazines, or picked up from Russian emigres, and those who interviewed her, either as supporters or doubters. Third, her meetings with those who had known the real Anastasia (and there were few living who had actually known her well) were often misleadingly reported, or ambiguities were seized upon. For instance, Nicholas II's sister, Grand Duchess Olga Alexandrovna, informed her biographer, 'German was never used in the family,' meaning, presumably, that Nicholas and family never spoke or wrote in German among themselves. There developed a heated debate over whether Anastasia had ever learned German, and attempts to deny this in the face of evidence were grist to the mill of Anna Anderson's supporters.

Greg King and Penny Wilson have done an enormous amount of research and taken care to go back to primary sources rather than relying on secondary works of questionable accuracy. They are to be congratulated on producing a lucid and convincing account which finally explodes the conspiracy theories which have raged for 90 years
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 31, 2011, 10:08:38 AM
I opinions as to AA being FS.  

Peter Kurth fully co-operated with Greg and Penny in their search for this book.  Greg and probably Penny will mention the help he gave them as this discussion continues here on AP.  

I find it quite offense for poster to degrade these three authors, who have always wanted to discover the truth about AA.  

Bear,

One, you have EARNED the right to use your alias with your years of reasoned questioning and research.  Two, you must not be very close friends with PK.  Your statement is wholly incorrect.  For the entire several years of the Resurrection project Penny and Greg have asked Peter repeatedly for his help and to read the manuscripts and provide his comments. Peter DECLINED to help in any way and did nothing to cooperate with the project, except his silence.

RealAnastasia. I have had dealings with Kurth for over fifteen years. Yes, I'm sad to say, he is totally capable of such behavior.  Do recall he was out of control on a flight from New York to London and was arrested on landing for his disruptive behavior.  I have a host of most nasty emails and posts from him. Everyone who has known Kurth for decades is quite convinced that Little Nell's posts were written by PK, even if someone else actually posted them on Amazon so Kurth can have "plausible deniability" when Amazon is subpoenaed for the posting records.

Bob and I talked at great length this morning about all of this. We have decided as follows:
We have worked with Penny and Greg on this book, our names are in it. We stand 110% behind their research and efforts and believe that any review of the book, wherever written, is fair game for discussion here WITHIN standard Forum guidelines of civility etc.  The content of those postings may be discussed here.  This thread, is after all about the book's content, and those reviews are focused on the content, as well as the Author's veracity, research and findings. They may be discussed.

Thank you

Rob
FA

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 31, 2011, 10:29:55 AM
Rob, I think you've perhaps forgotten that Kurth did provide considerable materials to King and Wilson at the outset of their project, at a time when he anticipated their research would bring them to the same conclusions he had made 25 years earlier.  My understanding is that Kurth declined to read the manuscripts of the near-completed work, which King and Wilson had offered to him as a courtesy since they were about to go public with conclusions that were at odds with the very public stake Kurth had put in the ground on Anderson's identity, both in his book and in later articles and web postings, even after the DNA evidence began to arrive.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on January 31, 2011, 11:14:00 AM
If I could I would say to Mr. Kurth:  "Peter, I understand you were friends with Anna Anderson and want to stand by her, but facts are facts.  Science has provied beyond a shadow of a doubt that she was not Anastasia.  You got taken, it happens.  It's time for you to come out and admit that you were wrong."
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on January 31, 2011, 11:20:31 AM
Rob, I think you've perhaps forgotten that Kurth did provide considerable materials to King and Wilson at the outset of their project, at a time when he anticipated their research would bring them to the same conclusions he had made 25 years earlier.  My understanding is that Kurth declined to read the manuscripts of the near-completed work, which King and Wilson had offered to him as a courtesy since they were about to go public with conclusions that were at odds with the very public stake Kurth had put in the ground on Anderson's identity, both in his book and in later articles and web postings, even after the DNA evidence began to arrive.

Tsarfan, I share completely your opinion. It's very convincing. Even me, believed that Penny's and Greg's results woulld reach the same point than Peter Kurth's. This was the reason I supposed they must have been payed off to get these results! (Yes; I know...It's a shame. But I didn't know what kind of results did they really got. By the moment, this is the absolute truth about AA's identity issue). I believed that what I supposed it was the case about Ernest of Hesse paying Gilliard, Penny and Greg must have been also payed to "switch possitions". Now, I clearly see it is not the case. But, since I can live with AA not being ANR, I swallowed the results of their research and ultimately, believed in what they're saying. No more dealing with a faked DNA or switched tissues, but with other great amount of objective evidence that shows that AA was indeed FS. I suppose that for Peter, it should be much harder than for me to accept the evidence of AA bieng an imposter. He REALLY believes in her claim.

Thanks for answering, Rob. That was nice from you ; I was not especting you would ever answer!

Now, back to the topic. We are here to discuss the book, after all, and not what people saids about it.

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 31, 2011, 11:44:27 AM
Rob, I think you've perhaps forgotten that Kurth did provide considerable materials to King and Wilson at the outset of their project, at a time when he anticipated their research would bring them to the same conclusions he had made 25 years earlier.  My understanding is that Kurth declined to read the manuscripts of the near-completed work, which King and Wilson had offered to him as a courtesy since they were about to go public with conclusions that were at odds with the very public stake Kurth had put in the ground on Anderson's identity, both in his book and in later articles and web postings, even after the DNA evidence began to arrive.

Thank you Tsarfan. Yes, I had forgotten that early on Peter provided his material to K&W, but once their change of opinion about the outcome of the research happened, he no longer wanted to participate. I find the fact that he had every opportunity to read every draft of the manuscript, and comment a priori to publishing, and now comes out to trash the contents for "inaccuracies" after the fact to be, well, shameful.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on January 31, 2011, 12:21:59 PM
RA, I'm afraid that "what some people say" sadly must be part of the discussion. For example, on Amazon, one "reviewer" ( LittleNell8 )  stated about the book "Some of their [King's and Wilson's] research is incorrect, some of it is merely name calling and some of it is downright dishonest . . . .Their book is nothing but a silly hoax, so full of mistakes that they almost don't seem to care that such mistakes are so noticeable."

They have accused King and Wilson of dishonesty and perpetrating a hoax with the book.  I am unable to reply on Amazon, as only those who bought the book via Amazon may reply or review  (Greg is most kindly sending us a signed presentation copy for our library. THANKS GREG!!).  Such defamatory and legally libelous statements must be addressed and defended. Particularly calling their research "downright dishonest" and a "hoax". Nothing could be farther from the truth.

Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Louis_Charles on January 31, 2011, 12:54:33 PM
I am also one of the posters on Amazon, under the name "Cantilever". I liked the book very much, as I said above, but of course people have the right to different opinions, provided they have the facts necessary to support those opinions.  Some of the "reviewers" has posted that King and Wilson used only the Hessian archives: demonstrably untrue. Others post subjective impressions as objective facts: Anderson's blue eyes were "unforgettable". I met her, and I don't remember them. That's not to say she didn't wow the socks off others, but this is a subjective impression, not evidence that she was the Grand Duchess.

The anti-ROTR "reviewers" (I grimaced a bit when I typed that, because most of them lack the thoughtfulness that a good review should have, and all of them lack the veracity) are claiming, among other things, that there will be a memoir released that will change completely how people view Jack Manahan (the worst thing I have heard anyone say about poor Manahan is that he was gullible. Which he was.) and that there is some kind of portentuous revelation coming that will astound the world. Uh-huh. Nothing is offered to back these claims, and in the meantime their poisonous "reviews" sit on Amazon.

And that's why people are writing rebuttals.


Simon
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on January 31, 2011, 12:59:20 PM
Rob, I think you've perhaps forgotten that Kurth did provide considerable materials to King and Wilson at the outset of their project, at a time when he anticipated their research would bring them to the same conclusions he had made 25 years earlier.  My understanding is that Kurth declined to read the manuscripts of the near-completed work, which King and Wilson had offered to him as a courtesy since they were about to go public with conclusions that were at odds with the very public stake Kurth had put in the ground on Anderson's identity, both in his book and in later articles and web postings, even after the DNA evidence began to arrive.

Very true--Greg King even noted here on the APF:

Peter did indeed assist us when we were researching the book. It is also true that he declined several offers to read the manuscript prior to publication and offer comments or corrections, which of course was his right.

The fracas on Amazon is more amusing than anything else-clearly an instructive lesson in bizarre psychology
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on January 31, 2011, 01:15:52 PM
This Little Nell character is really a train wreck that just keeps happening.

He/she has now posted twice on Amazon that the post calling King and Wilson "dishonest" and their book a "hoax" has been taken down, claiming at first that he/she took it down several days ago.  In fact, it's still up as I write this.

He/she seems to want King and Wilson and their publisher not to go looking for it but still wants to keep it up so others can see it.  The amount of bald-faced lying is simply incredible.

This kind of out-of-control craziness is rapidly overtaking the discussion of this book on Amazon, as the crazies have come out in full force.  The good news is that it's only about a half dozen people, so full force doesn't amount to much.

But Bear, I must say you have some interesting friends.  (And I think it's pretty clear now who they are.  Good luck.)

________________

In case anyone is confused about this, here's what LittleNell8 posted on Amazon:

"I honestly do not understand why there is this frenzy that Anna Anderson MUST be Franziska Schanzkowska. She clearly wasn't. King & Wilson have, in their quest seemed to have lost any ability they may have had to relate one situation to another, and look at it from an overall historical perspective. Some of their research is incorrect, some of it is merely name calling and some of it is downright dishonest.

If Franziska Schanzkowska is on Time Magazine's Top Ten Hoaxers list then I'm sure King & Wilson will, one day, be on the magazine's Top 25 hoaxers list. Their book is nothing but a silly hoax, so full of mistakes that they almost don't seem to care that such mistakes are so noticeable."

Going one day to be on a "Time" magazine Top 25 hoaxers list?

The Little Nell character also breaks out into periodic tirades against the Alexander Palace Time Machine forum.  It seems there is some personal agenda beyond which he/she cannot get.

Actually, Little Nell's posts have two separate strains of content.  Some of it originates with the poster herself.  Some of it is fed to her by Kurth, who is using her as a posting shill, as some of the posts contain arcane references and inside jokes that several people who know Kurth well recognize as emanating only from him.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on January 31, 2011, 01:35:34 PM
OK - I don't understand why anyone would want to write a review on Amazon in the first place.  I actually did only twice on books that have nothing to do with Russia or the Imperial Family and then I thought, who the heck am I to be posting my opinion about any book?

Of course I have my opinions, but I am not a professional writer (not yet anyway) nor a professional reviewer and so what I think doesn't amount to a "hill of beans' as someone once said in a movie or two.

It must be hard for those who were "hood winked" by Franziska all those years to have to admit that they were conned.  Especially since so many put their professional reputations on the line for her.

As the old saying goes, "Fool me once, shame on you.  Fool me twice, shame on me."  I think being fooled twice has hurt some people very deeply and they are taking their frustrations out on Greg and Penney since Franziska is now departed.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on January 31, 2011, 01:49:01 PM
If I can try to steer this back to point (and perhaps all DNA questions should go into some new thread in the Myth of Survivors under an FS heading or something):

Originally we did deal with the alleged 1916 trip by Ernie at great length-but it got cut because we had to cut the word count from 160,000 to 140,000. In the end, we agreed that the important point about it was not whether it had taken place or not-it was whether the ALLEGATIONS about it were so secret that AA's mention of them revealed intimate knowledge only Anastasia would have possessed. And as we show, clearly the answer to this was no.

The arguments about the trip belong to another book or issue but seemed ultimately out of place in a book on AA because it was knowledge of the alleged visit, not the visit itself, that was key.

And maybe those 20,000 words can go into an eventual biography on GD Ernest--hope springs eternal.  :) As a side note to Greg and Penny--I bought all your joint and separate recent books (not just royal but the one on Mrs Astor's 'Court' as well) and just sent a lady out of the library a couple weeks ago with 2 of them (Court of the Last Tsar and Twilight of Splendour) and she reported that she greatly enjoyed them. She is very interested in this new book as well when it finally arrives and the cataloger (ahem) gets around to finishing it (I mean cataloging it) herself.

And the comments under the 1 star post have increased by 20 since yesterday. The book is certainly stirring up controversy, which, hopefully will be good for sales if nothing else.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on January 31, 2011, 09:37:04 PM
Greg King has himself posted a response to the Amazon review that addresses the point about what archives were/weren't used amongst other points:

"Contrary to what is being stated, as the authors of The Resurrection of the Romanovs, we worked in and drew upon multiple archival sources and collections. In addition to the Staatsarchiv in Darmstadt, this included Russian archives, the Hamburg trial files in Hamburg (all evidence assembled both pro and con), the private collections of Ian Lilburn and Peter Kurth (both believers that Anna Anderson was Anastasia), and numerous others. Efforts to insist that the book rests only on work in the Staatsarchiv simply show that the poster has not read read the book or is ignoring the multitude of sources, on both sides of the issue-yet another example of how fact becomes so frequently twisted in this case. "
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on February 01, 2011, 03:29:38 AM
Interestingly, the hostile reviews must be appearing only on Amazon US. When I looked on UK Amazon yesterday, there were five reviews besides mine, all but one favourable.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 01, 2011, 08:46:24 AM
Interestingly, the hostile reviews must be appearing only on Amazon US. When I looked on UK Amazon yesterday, there were five reviews besides mine, all but one favourable.

Ann

The reviews are good but in the comments there are still a few posters who insist the book is wrong and AA was Anastasia. However, the tone is nowhere near as bad as on Amazon.com.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on February 01, 2011, 10:13:51 AM
...[in part]...

But Bear, I must say you have some interesting friends.  (And I think it's pretty clear now who they are.  Good luck.)


....

I have dined with presidents  and feed chickens in the mornings....  Yes,  I do have some interesting friends.

AGRBear
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 01, 2011, 11:56:10 AM
There were NO reviews on the Amazon Canada site.  Well there is one there now, mine.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on February 01, 2011, 01:57:23 PM
All hell's about to break loose over on Amazon if anyone wants to check the comments under "Thubten Namdrol's" review.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 01, 2011, 02:10:45 PM
Nice to see the AP Forum dragged into it even further--including the Oma Hamou disaster (what's a strong enough word for that situation?). I think our posters would do well to stay away from posting in the comments site there as it looks like it's becoming less a review and more a slug-fest and we don't need to participate or fan the flames. After all, there are only the 3 negative reviews (2 1-star and 1 2-star) and the bulk of the nastiness is in the comments. Those people will never be convinced either a) that AA was FS or b) to hold a rational review discussion so it's just a goat-roping exercise at this point no matter what the intentions. Anyone who wants to help, buy (or borrow) the book and write a decent (in terms of writing, not necessarily star-rating) review of it. Otherwise, we are probably well out of it. I don't think Bob or Rob need some things dredged up further even in the name of defense. They've managed to keep most of that stuff off the Forum and behind the scenes.  :(
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 01, 2011, 02:20:38 PM
I found this photograph of Jack's tombstone on the web. I have to correct myself from my earlier post, Anna's section reads "HIH Anastasia of Russia", not "Anastasia Nikolaevna"

If you click see full size image towards the top, you can see the full image better:

http://www.google.com/imgres?imgurl=http://www.readthehook.com/blog/wp-content/uploads/2009/02/news-anastasiagrave-med.jpg&imgrefurl=http://www.readthehook.com/blog/index.php/2009/02/14/annas-versary-anastasia-manahan-recalled-25-years-after-death/&usg=__8faTWexmpR_TrIEeHRRB_y8kKuM=&h=675&w=900&sz=298&hl=en&start=80&zoom=1&tbnid=iqH6EAi86qiTpM:&tbnh=110&tbnw=146&ei=pjQ8TbbyI4zVgAfngsW-CA&prev=/images%3Fq%3Danna%2Banderson%2Bmanahan%26start%3D60%26hl%3Den%26safe%3Dactive%26sa%3DN%26gbv%3D2%26tbs%3Disch:1&itbs=1

The man the interview is about is a staunch defender of her not being FS in the reviews of the book on Amazon--Robert Crouch.

I guess he still believes what AA told him:

"I wish I could tell you what was told to me about the retinue at Hemmelmark, but I have to keep it quiet until my memoirs are complete and until I am able to catalogue the supporting evidence.

As for the Schankowska family being nobility, I can tell you that there is a theory among those of us in the inner circle that they were not Polish nor Kaschoubian, but rather the descendants of Dutch canal builders . It is well-known among ethnic cartographers and genealogist that Dutch Mennonite
canal builders settled in the Kaschoubins region in order to drain the swampy lands of Pomerania.

How does this possible fact affect the Schankowska hypothesis? I am still not sure, but there may have been two Schankowska families and King and Wilson have identified the lienage of the wrong one."
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on February 01, 2011, 02:21:57 PM
I talked with Rob before putting up the post on Amazon.  He understands that the AP has been dragged into this by others over on Amazon, and he was fine with the comment that was posted that brings the hidden agenda to light.  People here should understand just how crazy some of the people are who haunt these Russian history forums.

At one point, the overall rating of the book on Amazon dropped to 3.5 due to the negative posts of those who had personal agendas against the authors or others.  Things will not just take care of themselves.  More people have to be willing to become involved in holding the craziness within reasonable bounds.

I do agree certain names should not be mentioned here.  Let it play out on Amazon as long as it does.  But people here might at least want to know it's going on.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 01, 2011, 02:24:51 PM
Yes, but does it have to be dragged back onto the Forum? Some of those posters were kicked off here for a reason--their poison spreads quickly and easily. Especially such things as the OH mess which most people don't know anything about.  :-\ :(  It'll probably be chalked up to the "AP Gang" and their evil cabal picking on them.

I don't disagree they're crazy over there--and was doing some googling on them myself--but we don't want to get too off-topic here.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 01, 2011, 02:33:55 PM
Robert Crouch in his comments about the book cites the following (his proof being Anastasia, ie AA aka FS, told him so K&W must be wrong):

"Neither source cited actually cites any primary source as proof that Nicholas II had an actual tattoo made or at least not one that was large enough for anybody to recognize it. The procedure may have been practiced,but not completed. Anastasia may never have known about the tattoo because it was simply too faint or unrecognizable if it existed. If Nicholas II did have a small tattoo, he may have shared it with a fellow military man such as Felix Dassel before he would with his children. At any rate,
the point about Anastasia's recognition or lack of recognition of this possible fact is like much of King and Wilson's book heavily dependent on conjecture and the liberal use of the subjunctive mood. "

"If Nicholas II had a large dragon tattoo, then why didn't King and Wilson include a picture of Nicholas with his tattoo? They say it was on his right arm, yet it is not apparent in any of the photos I have observed in my career. Given that a tattoo is a sign of a person of low class origin, it is entirely possible that the Tsar hid its existence from his children, if, of course, he actually had anything that was intense enough to be called a real tattoo.
At any rate, King and Wilson consistently fail to include examples of primary source material that would prove some of their so-called "innovative research". "

""Well, why were the pictures not used in the book? Even primary sources such as newspaper accounts can be and often are altered by reporters to make the event
more readable or interesting to the reader. I know this to be a fact based on personal experience. As for a clear understanding of the differences between primary, secondary, and tertiary sources and how they may be corrupted or misintinterpreted by researchers, I refer you to "The Modern Researcher" by Barzun & Graf. " (And that's a misinterpretation of the book which I needed for my degree)

"I think that you are missing the point that save for a handful of poorly backed points, King and Wilson are simply repeating the same tired old story from the 1920's about Schankowska. If Baron Berenberg-Goslar was such a good lawyer, then why did he not demolish Anastasia's claim with all the evidence that he had? The explanation that they give make him look like the world's most incompetent dime-store lawyer. Remember, he was the one who organized the Darmstadt archive at about age 90. BTW: I met Botkin when I was very young. "

It is like bizarro world--though RC doesn't seem nearly as poisonous as the others, just someone unable to let go of the fact that everything he knows is wrong because the person who told him those things was lying. I have a good deal of sympathy because, having looked him up somewhat, I see that he was very good friends with the Manahans (and is quoted a good bit in James Blair Lowell's book) in their later years. He sees AA in a very human way--she's not just a historical figure or an object of mockery or someone to be debated. She was his friend and it must be hard to look at things with an unbiased eye in such a case.

Of course, he will be coming out with his own book: "Well, it is refreshing to know then that you will value my memoirs of Anastasia when I have them published in the near future. I knew her and Jack Manahan very well and I can tell you categorically that the whole story has never been told. I had a certain amount of access that outsiders did not. "
"First, Yes, it will address the issue of the DNA tests in all seriousness. Second, it will address who Jack Manahan really was and not the comic book version presented
by Frances Welsh and repeated by King and Wilson. Third, it will will reveal details that were kept from both biographers Kurth and Lovell. Details that would have adversely affected persons living at that time. Fourth, I would not call it a thriller, but rather, a memoir and a tribute to some very good people who were my friends over the years. "
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Tsarfan on February 01, 2011, 02:35:16 PM
I don't disagree they're crazy over there--and was doing some googling on them myself--but we don't want to get too off-topic here.

Agreed.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 01, 2011, 02:38:56 PM
So as to the points by RC, HIS primary sources can't be considered truthful because AA wasn't AN but K&W's sources are flawed because they were from the Hesse archives and such logic.

I do anticipate getting the book even more now if only to look at the acknowledgment sections.

And a big (somewhat off-topic) thank you to Penny & Greg and their publisher who made the book available on Kindle! It is so difficult to get royal books that way.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 01, 2011, 04:32:00 PM
Amazon needs to screen it's posters more carefully.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Suzanne on February 01, 2011, 04:49:19 PM
I am looking forward to reading this book - in fact I am dropping hints to my fiance that it would be a welcome Valentine's Day present!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 01, 2011, 07:51:58 PM
Believe me, you'll enjoy it.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 01, 2011, 09:09:27 PM
Amazon needs to screen it's posters more carefully.

The title of LittleNell's review has now been changed to: Skip my review, go to the comments instead. They'll blow you away!

Nothing like pulling attention away from the BOOK to yourself.

Lisa Davidson wrote a very good REVIEW (not a diatribe) on the book. Still waiting for our copy to arrive at the library. I may be reduced to a Kindle copy soon!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Louis_Charles on February 01, 2011, 10:47:02 PM
If you have read your way through the comments on Amazon.com, then I assume you are aware that part of the attack is directed not at King and Wilson, but at this forum and its members. And if you have read the book, I would encourage you to go and make your views known by either posting a review, as I did, or commenting on those reviews that are demonstrably erroneous. King and Wilson consulted far more than the Hessian archives, for example, and that point needs to be made as often as possible. What the comments and negative reviews attempt to do is destroy their credibility as historians. No evidence is offered, just baldly untrue statements (the Hessian archives, etc.) and mysterious promises of great revelations to come. So in essence we are dealing with character assassination. At least one of the posters has not read the book at all.

This topic  (Anna Anderson = Anastasia Nicholaevna) obviously inflames people, but an academic discussion isn't based upon personalities, rather, marshaled facts. Tsarfan has been withering with his logic and truly formidable grasp of the evidence, and since they cannot impeach him on his arguments, several posters are going after him personally. I think it would be a good idea if members of the forum demonstrated a little solidarity.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: RealAnastasia on February 01, 2011, 11:01:44 PM
I do not know exactly when I'll have "Resurrection of the Romanovs".To purchase a foreign book is very expensive here, for you'll be paying it four or five times its real cost. We had had a devaluation in our money. But I manage to buy it, anyway. I've read FOTR and now I think it will be a great complement. In Argentina, the only translated books of Greg are "Yussupov; the man who killed Rasputin", and "The Last Empress"...and of course, I have both of them, as well as FOTR. I appreciated them so much, that I read and re-read them every six months at least!  ;D

Back to the topic: I think that the only way to deny what Penny and Greg exposes in this book , is to show different and CREDIBLE documents to answer their question in a different way they did. They quotes their sources, so you are able to go to Europe, search in the archives and find just the same they did. If some people   wants to write a story showing that AA was not FS, they must to find also CREDIBLE and TRUE documents who said different things than the ones Penny and Greg saids in their book. I suppose it will not be easy. If those people achieves it, I'm ready to believe them. They know that I'm saying the truth. If the only thing they do is to show theories without proof...they will not believable as much as they shouts out that Penny and Greg are lying.

RealAnastasia.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on February 02, 2011, 09:41:37 AM
I just went to Amazon to read some of what was posted about the book.

I makes my head swim!  I thought that we were all supposed to be adults and that we had left the kindergarten sandbox behind us a number of years ago.

I had to stop reading because I don't think there is enough time in my life to go through all of the reviews and the comments on those reviews.

I think Resurrection of the Romanovs stands on its own.  Just as I thought that Fate of the Romanovs also stood on its own.

I am surprised that Amazon is letting this "comment/review" argument go on.

I personally liked the review by Stephen Wroblewski:

It was to be expected, I suppose. Someone writes a book (and a very well-researched one, at that) sounding the morning alarm for the dreamers to wake up and put their visions of hair-raising escapes, lost princesses, and wicked aunts behind them for a long day as an adult.

But what happens? The dreamers knock the clock off the nightstand, turn back over, and re-enter darker dreams now haunted by evil DNA strands, diabolical photoshoppers wielding images of tattoos, and . . . now making the dream a true nightmare . . . turncoat authors.

(Sorry, folks. You have to read the comments under the negative reviews to get all of the above. But it might be worth it.)

With this book, the Anna Anderson case has been snatched from the hands of dreamers and turned over to historians. And it's about time.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 02, 2011, 11:10:40 AM
Quote
I am surprised that Amazon is letting this "comment/review" argument go on

I agree.  A lot of these are not so much reviews as Flat Earthers throwing a tantrum because they can't handle that their cause has been debunked by science.  In the words of the immortal William Shatner, these people need to "get a life!"

All quiet on the Canadian Amazon site.  My review is still the only one there.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Suzanne on February 02, 2011, 06:05:18 PM
I've noticed the book hasn't been heavily publicized in Canada - my local Chapters and independent bookstores don't have it in stock, which may be why the amazon.ca page is so quiet!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 02, 2011, 06:37:59 PM
Amazon.uk is also mostly quiet--and mostly positive reviews. The only 1 star comes from someone who posted a 1 star on Amazon.com. Should that be allowed? Either you bought the book in the US or the UK.

They drag the whole 'who is the rightful heir' into the review as well. Seriously?

"I also want to point out that in this book the authors state that Grand Duke Cyril was the rightful heir to the throne and that was not accepted by the Doweger Empress and many members of the family when he proclaimed himself so but even if he was his son Wladimir lost that right when he married Leonidas Bagration who was a divorced woman and not considered of equal rank as the Georgian Royal family had become feudal to the Tsars... and then of course their daughter Maria married Prince Franz Wilhem of Prussia and according to the Pauline laws became a Prussian Princess. Their son thus has no right whatsoever to be styled Grand Duke of Russia as he is Prince George of Prussia. If this claim by the authors is not a manipulation then please let me know what is? "

I'm not one for censorship but one of those reviews should have to go. Where post next--Amazon.de? You should post (and a real review at that) in the country you live in and this poster, based on their profile, lives in NY.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 02, 2011, 08:03:21 PM
Quote
my local Chapters and independent bookstores don't have it in stock, which may be why the amazon.ca page is so quiet!

Well, I got mine through Chapters.  Although I  didn't buy it in the store, I ordered it through their Kiosk service.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 04, 2011, 04:57:32 PM
Incredibly the tattoo argument is still being used against the book. Here's a phto from the Beinecke albums (#2, page 9, 2nd photo, in case anyone wants to verify)

(http://img.photobucket.com/albums/v441/grandduchessella/russia/00064013a.jpg)

(http://img.photobucket.com/albums/v441/grandduchessella/russia/00064013.jpg)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on February 04, 2011, 05:14:42 PM
I see a very large dragon tattoo.  It is faint, but clearly visible from his elbow to a point above his wrist. Not that little scratch that is highlighted.

I think that since Nicholas himself mentions it in his diary, then it is a primary source that he did get a tattoo in Japan as did George V and other royal sailors and visitors.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 04, 2011, 05:57:00 PM
One can see other photos of the tattoo on a thread in Nicholas's sub-forum. I did a 'tattoo' search. I had posted this (and a link on Amazon) since they came directly from Beinecke and can't be accused (as other photos on here have in the reviews) of possibly being doctored.  ::)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: EmmyLee on February 04, 2011, 06:05:46 PM
Success! I suggested that my library should purchase a copy of this book and it's on order.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 05, 2011, 01:07:52 AM
That's nice to hear.  It's a great book.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 07, 2011, 10:35:37 AM
Original one star review by LittleNell removed a replaced with a VERY brief one (still 1 star though). ALL the comments have been removed which I have never seen done before. Usually when a comment is removed by poster or by Amazon there remains a message about it being removed and by whom. I guess it happened because LittleNell deleted, not revised, her original review. This is like they never existed. 3 new comments have been posted since the new review. Hopefully, more can be focused on the actual BOOK but the derision (by a friend of Anna Anderson's, Robert Crouch) has already begun. Main complaint--authors too subjective. Pot, meet kettle!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Laura Mabee on February 07, 2011, 04:19:53 PM
I have to say sheepishly that I have yet to completely finish the book.

I just read through the last 26 pages of this thread and man..... Drama for everyone's mamma!

First off, I have to say that I appreciate FA for taking the time to explain DNA testing, I was one of those many who was rather confused by it, but no longer! 
I am very excited to have Mr. King and Ms. Wilson here with us to discuss the book! What a treat.

Secondly, it would be nice if people could put their grown-up pants on and deal with difference of opinion in a mature manner. The mud-slinging that goes around really baffles me sometimes.

I look forward to finishing this great publication and appreciate the opportunity given to us to discuss the topic with the authors!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on February 07, 2011, 07:18:22 PM
Since I know many of the writers currently working on late Romanov history, I have always tried to keep the Forum a place where they can post and answer their readers' questions. This was a remarkable failure in the case of "Fate of the Romanovs". There were times when I wanted to leave the Forum, as attacks on the authors were often petty or personal or both! I sincerely hope that we can maintain a mature level of discourse, but I am not holding my breath.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on February 07, 2011, 08:20:14 PM
I think the last few pages at least have been very mature--certainly nothing like the prior FOTR discussion nor the discussion (since deleted) on Amazon. THAT was the kind of craziness you reference and involved at least one former member who contributed to the FOTR disaster. I have high hopes for this thread. Perhaps it's a less emotional discussion since, except for True Believers who will never be convinced, the DNA put the case to rest. FOTR dealt with very emotional issues and many felt shattered some illusions. This is a very objective book it seems and weaves rather a mystery of how AA 'became' Anastasia for so many. I just don't sense the same receipe for disaster. Perhaps if there hadn't been conclusive DNA it would be different. Also, we have a number of different posters (and an increased number of mods!) here from before so that might help.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Laura Mabee on February 07, 2011, 10:16:49 PM
Oh yes. I apologize. I should have clarified, I wasn't saying that the drama was necessarily on the AP, I was more referring to the Amazon review site.
We've been pretty good thus far. : P
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on February 07, 2011, 11:30:57 PM
Factually there were numerous errors cropping up in the actual Amazon reviews and comments related to the actual book, but it is best that Penny and myself not get involved in a back and forth there, which would lead nowhere. However we're happy to answer any questions here or address anything if anyone has specific questions about the book or about anything being raised as a "reason" to dismiss the book.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 08, 2011, 11:53:46 AM
Yes, I like the dicussions here.  No trolls allowed.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 10, 2011, 04:56:01 PM
LittleNell has found her way to the Canadian Amazon site.  I just shook my head at her review, this is a true Flat Earther.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Robert_Hall on February 11, 2011, 12:35:21 PM
Amazon. like APF is a privately owned  entity. It is commercial as well. You can be sure they have  banks of lawyers to prove they have the right to post these comments, whether or not they  agree with them. They stay objective, in a commercial way. That is, the more controversy that a book, any book, creates, the more sales. That is the point of the business, is it not?
 King & Wilson are  pretty thick skinned with all of of this,  so  I hope all the BS sent their way only provides more pennies in the respective pockets.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 11, 2011, 04:36:04 PM
Still it's amazing some people can be so stubborn to close their eyes to the truth.  Science has proven that AA was never Anastasia, case closed.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: AGRBear on February 14, 2011, 10:21:13 AM
One of the mysteries about FS was how she received her scars.   Greg and Penny tells us on p. 283.   It occured while she was working on the German estate of Gut-Friederikenhof.  For those who might be curious about this estate,  evidently it still exists and you can find some marvelous photos of it on the following URL:

http://www.gut-friederikenhof.de/index.php?option=com_content&view=article&id=65&Itemid=101

Click on "Galerie" and then "Herbst"  [autumn].  It will show the various crops still being grown there today.

Click on "Startseite" and there is a short movie which will show you more of the buildings on the estate.

If you can't read German go to google,  write in Gut Friederikenhof,  next to it you'll see "translate",  click on it and it'll give you the English version.  They don't have one on the official site.


AGRBear
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kransnoeselo on February 14, 2011, 03:57:16 PM
Great job AGRBEar! It would never have occurred to me that the estate would still be up and running. Bravo!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on February 15, 2011, 01:13:32 AM
Nice to see some buildings from back then still exist, despite the devestation of two World Wars.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Suzanne on March 03, 2011, 11:22:59 AM
I am currently reading this book (I'm about a hundred pages in) - here are my thoughts so far:

I am very impressed with King's and Wilson's critical analysis of the Anna Anderson case, particularly the manner in which she was established as "Anastasia" in the 1920s. I thought the chapter about the Gilliards and Olga Alexandrovna was particularly well written as the interpretation of these visits was extremely significant to the debate concerning Anna Anderson's identity. The authors have supplied useful background information concerning key "interested parties" in the case, which helps illuminate their biases.

The only section of the book that has disappointed me (comparatively) so far is the opening chapters about the real Anastasia. With the exception of the sections about the inner workings of Marie's and Anastasia's hospital, I didn't feel like I learned many new things about Anastasia's life. I have read the memoir literature that was discussed in this section and recognized most of the quotes concerning the Grand Duchesses' upbringing. I feel this section could have been improved by an expanded discussion of popular perceptions of OTMA during their lives (King and Wilson do this during the romanov tricentennial section but could have expanded their ideas). Long before the murder of the Imperial family, there was extensive coverage of the Imperial children in the foreign press. This popular interest laid the foundation for the interest in Anastasia's "survival" and I would have been interested to read more about perceptions of the Imperial children in the press.

I am enjoying the book and look forward to continuing to read it.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Michael HR on March 03, 2011, 12:05:34 PM
Just placed my order (had a gift voucher outstanding) so looking forward t a good read!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on March 03, 2011, 12:40:33 PM
I am currently reading this book (I'm about a hundred pages in) - here are my thoughts so far:

I am very impressed with King's and Wilson's critical analysis of the Anna Anderson case, particularly the manner in which she was established as "Anastasia" in the 1920s. I thought the chapter about the Gilliards and Olga Alexandrovna was particularly well written as the interpretation of these visits was extremely significant to the debate concerning Anna Anderson's identity. The authors have supplied useful background information concerning key "interested parties" in the case, which helps illuminate their biases.

The only section of the book that has disappointed me (comparatively) so far is the opening chapters about the real Anastasia. With the exception of the sections about the inner workings of Marie's and Anastasia's hospital, I didn't feel like I learned many new things about Anastasia's life. I have read the memoir literature that was discussed in this section and recognized most of the quotes concerning the Grand Duchesses' upbringing. I feel this section could have been improved by an expanded discussion of popular perceptions of OTMA during their lives (King and Wilson do this during the romanov tricentennial section but could have expanded their ideas). Long before the murder of the Imperial family, there was extensive coverage of the Imperial children in the foreign press. This popular interest laid the foundation for the interest in Anastasia's "survival" and I would have been interested to read more about perceptions of the Imperial children in the press.

I am enjoying the book and look forward to continuing to read it.

The reason why there wasn't much "new" about Anastasia was because the authors wanted the focus to be on how FS pulled it off, not a new biography of Anastasia, that section was intentionally written so that the reader who was not familiar with the "real" Anastasia would understand, it was not written for those who already are very familiar with the Imperial Family.  Also, remember that editors had their hand in this to keep the book to the present length, and much background material was sacrificed so that the "how FS did it" part would be left.  The original manuscripts would have been more to your liking!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Laura Mabee on March 03, 2011, 02:33:04 PM
Also, remember that editors had their hand in this to keep the book to the present length, and much background material was sacrificed so that the "how FS did it" part would be left.  The original manuscripts would have been more to your liking!
That is such a tease! (http://img.photobucket.com/albums/v288/n_sane_peace/Smiles/happy.gif)
I do hope that maybe Mr. King and Ms. Wilson choose to use that research for a future publication!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Alixz on March 03, 2011, 02:46:20 PM
I was just thinking that as well.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on March 03, 2011, 04:20:09 PM
It really is a good look at how FS, and those around her, pulled it off.  She may not have been Anastasia, but she has secured a place in history none the less.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Suzanne on March 03, 2011, 09:49:08 PM
Now I really wish I could read "the director's cut" of King and Wilson's book!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on March 04, 2011, 09:28:29 PM
Hi Suzanne

The chapters on Anastasia were meant only as a kind of brief layout of her life, and were added in at the last minute at the editor's request, at a time after we had actually concluded most research. This made it impossible to really get at new materials about her life, but the chapters at least offer a few important points on her life like the fact that she was learning German as late as the captivity in Tobolsk, etc. But they really exist only so that readers unfamiliar with the story get a sense of Anastasia before we meet AA.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Suzanne on March 04, 2011, 09:48:30 PM
Hi Greg,

Thanks for responding to my comments. It's interesting to know the process of putting a book like this together. I have finished Resurrection of the Romanovs now and found it fascinating. You and Penny have done an excellent job of deconstructing how Franzinska suceeded in convincing so many people she was Anastasia.

P.S. I picked up Gilded Prism last year at Gagliani when I was in Paris and greatly enjoyed that book as well - the Konstantinovichi were an interesting family and should be better known than they are.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on March 05, 2011, 01:03:43 AM
Yeah, Greg and Penny wrote a great book.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Michael HR on March 06, 2011, 06:14:58 AM
Mine has arrived and so looking forward to getting through it
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kitt on March 11, 2011, 02:48:24 PM
I just finished the book.  A terrific book.  I was amazed, once it was explained, how FS absorbed like a sponge, all the tiny bits of info that came her way. She was truly talented in that respect.  And that she actually got caught in her story several times, and was able to recover due to a desperate wish of others to believe her story...  I wouldn't be surprised to see this story, as Greg King and Penny Wilson wrote it on the big screen.  What a production that would be!  All the best, Kitt
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Suzanne on March 11, 2011, 10:45:37 PM
I think the title of the film should be "Becoming Anastasia"
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on March 12, 2011, 07:05:16 AM
That WAS our intended title for the book, actually!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kitt on March 12, 2011, 06:04:22 PM
"That WAS our intended title for the book, actually!"

So.. Perhaps you will write a screenplay.
All the best, Kitt
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Suzanne on March 18, 2011, 07:18:03 PM
I vote for Mia Wasikowska (Alice in Wonderland, Jane Eyre) to play Franzinska Schanzkowska in the film version of "Becoming Anastasia." She has a really good range as an actress. I think it would be a complex part to play - a person who assumed another person's identity to escape her own unpleasant life but convinced supporters and detractors alike that she was not "trying" to be someone else.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Horus on April 24, 2011, 06:41:36 PM
I am almost finished reading the fantastic book (the last chapter on FS). I am applauded to both Greg and Penny for their excellent work on the complex case in the twentieth century. I am so grateful to have them, who wrote another brilliant book (TFOTR), and also told us what happened to the imperial family in Ekaterinburg, that they've managed to answer my countless questions on how did FS convince people that she was Anastasia. Those gave my mind a rest at last. I am glad to have this book on shelf beside with TFOTR. Thank you!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on May 06, 2011, 01:49:41 PM
I have no fear about pointing out the gorilla in the corner. It is indeed sad that Peter Kurth is hiding behind the "Little Nell" name on Amazon to try to trash the book. Even worse is his refusal to read and comment on the manuscript before publishing and now come out and make these allegations.

The most telling thing to me about the lunacy on the Amazon reviews is that every single person who supports the book and Penny and Greg uses THEIR OWN REAL NAME. The ones who want to trash it hide in darkness with made up pseudonyms ("little nell" and "Chat Noir") because they do not have the courage and conviction to speak with their real names. That alone should tell you about their agenda and mind set.

Pathetic.

The other day I finally finished reading all the crazy comments in some of the reviews on Amazon and it took me something like 3-4  days, on and off... It was rather entertaining, but I am really amazed that this stuff about AA is still going on... Pathetic indeed. I posted my own review of the book there and was fully expecting comments from some of these people, which of course I was going to ignore, but none came.. I don't know if that's a good thing, or a bad thing LOL. 

BTW, is 'Little Nell' really PK? Poor PK, he has finally completely lost it if that's the case...
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on May 06, 2011, 01:53:42 PM
HarryB is the same Harry Binkow who posted that same trash, the guy from Athens Georgia, on the previous page.

Maybe he is Alec Knight from Stanford? He used almost identical words to tell us that more information will be forthcoming about the Romanov remains, now 5 years later we are still waiting...   ;)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on May 06, 2011, 02:11:56 PM
OK - I don't understand why anyone would want to write a review on Amazon in the first place.  I actually did only twice on books that have nothing to do with Russia or the Imperial Family and then I thought, who the heck am I to be posting my opinion about any book? Of course I have my opinions, but I am not a professional writer (not yet anyway) nor a professional reviewer and so what I think doesn't amount to a "hill of beans' as someone once said in a movie or two.

I think amazon reviews are meant to be from readers not from the professional reviewers or other authors, and I also think that a lot of people do go by them when they make a decision to purchase a book... I know I often do. Most of my reviews are on Goodreads and on my library's webpage, but I do put some of them on amazon, along with product reviews... 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: grandduchessella on May 06, 2011, 02:43:08 PM
They are going crazy on Amazon.uk. For awhile some from here were fighting the good fight but they are just impossible over there. Someone who had written a 5 star review of the book did his own facial analysis and viola! came to the conclusion that AA was AN. He then changed it to a 3 star review (how generous) and they've all been back and forth congratulation themselves on how much smarter they are than all the non-believers. It's really quite sickening the level of smugness.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on May 06, 2011, 04:01:20 PM
I wonder what these guys' take on Osama Bin Laden's death and DNA results is ;) 
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: billmcl2 on May 08, 2011, 11:28:27 PM
BTW, is 'Little Nell' really PK? Poor PK, he has finally completely lost it if that's the case...

It wouldn't surprise me. Prince Romanov (Prince Wingnut, as I call him) had links to some of Kurth's recent writing on his YouTube channel but has since removed them. If PK is endorsing this crackpot then he really has lost it!

http://www.youtube.com/user/PrinceRomanov#p/u/2/EuQnx_IpX6o
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on May 10, 2011, 04:51:09 PM
This book should lay any such nonsense to rest for good.  Greg and Penny did a great job.

PK and those other Flat Earthers need to realize that Anastasia died in 1918, was murdered with the rest of them.  Case closed.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Helen_Azar on May 12, 2011, 01:40:13 PM
PK and those other Flat Earthers need to realize that Anastasia died in 1918, was murdered with the rest of them.  Case closed.

Sorry, will never happen  ;). You are underestimating the power of human stupidity...
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: LisaDavidson on May 17, 2011, 12:10:15 PM
Some people won't let facts stand in the way of a lousy preconception, or their own ignorance!  :)
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Forum Admin on May 17, 2011, 02:30:47 PM
PK and those other Flat Earthers need to realize that Anastasia died in 1918, was murdered with the rest of them.  Case closed.

Sorry, will never happen  ;). You are underestimating the power of human stupidity...

NEVER underestimate human stupidity!!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: imperial angel on October 27, 2011, 10:28:24 AM
I recently read this book (I know, a little late) and thought it was a great book that cleared up a lot of things I found confusing in other books about AA( a lot about her claim with the little details, languages, memories, who she "recognized" from her past and when, was confusing precisely because it didn't add up to a coherent whole), and that clearly shows she never could have been Anastasia, and why.It seems to be the last word on the subject to me.Then again, the meaning of Anastasia's name was Resurrection, a name that fitted AA as well (even though her real name was the more prosaic Franziska).
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on October 27, 2011, 10:52:30 AM
Imperail Angel

I agree - it answers the questions.

But some people still believe the earth is flat there are people insisting on Amazon that AA was genuine!

Interestingly, Herman Goering was at one point a patient at Dalldorf Lunatic Asylum - when he was first addicted to morphine in the 1920s he was sent there as 'a dangerous drug addict'.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on October 27, 2011, 10:57:20 AM
Quote
Interestingly, Herman Goering was at one point a patient at Dalldorf Lunatic Asylum - when he was first addicted to morphine in the 1920s he was sent there as 'a dangerous drug addict'

I wonder if he was there when AA was there.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Sunny on October 27, 2011, 11:15:09 AM
Quote
Interestingly, Herman Goering was at one point a patient at Dalldorf Lunatic Asylum - when he was first addicted to morphine in the 1920s he was sent there as 'a dangerous drug addict'

I wonder if he was there when AA was there.

having the girl who survived - the only living daughter of Nicholas escaped the murder... what a anti - comunism, rirresistible piece of propaganda could thishave been for Goering!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on October 27, 2011, 12:06:49 PM
'I wonder if he was there when AA was there.'

That's what I'm wondering, though Goering was at the nadir of his fortunes then, and with no power or influence whatever.

Of course, the Nazis later liquidated several thousand mental patients - presumably Goering kept pretty quiet about having been one!

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Lady-in-Waiting on October 27, 2011, 01:00:03 PM
According to King & Wilson's Resurrection of the Romanovs, AA left Dalldorf in May 1922. But Goering's morphine addiction didn't begin until after he was shot during the Beer Hall Putsch in November 1923, so he must have been there later than AA.

In any case, Dalldorf had a dozen buildings and averaged more than 1500 patients at a time. Even if they had both been in the asylum at the same time, it's unlikely they would have met.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: stepan on October 27, 2011, 07:40:03 PM
In fact AA had been a patient in Dalldorf twice. First some months at the beginning of 1917 and then again in 1920.  This according to King and Wilson. I was rather surprized when I read this. That noone remembered or recognized miss Unkown. Even if it was a big hospital with many patients someone should have remembered her. But for some reason noone did and the world got this fantastic Anna Anderson story!
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Greg_King on October 27, 2011, 08:26:06 PM
No one remembered her because the institution was so large-and, as we said in the book, why would they? It is a measure of how insignificant and alone Franziska was that she made no impressions and had no friends.  Add in the staff turnover and the patient turnover during the war and after, the passage of several years, patients being in different buildings tended by different staff-and you have a reasonable explanation.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on October 28, 2011, 10:56:44 AM
Yeah, it was not until later that she became well known.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Romafan96 on September 06, 2015, 12:02:17 PM
I don't think Nicholas would have wanted to rule again, even if it had been offered.  His writings give no indication of this.  He might have been more than happy to spend the rest of his life in exile on a farm somewhere sawing wood.

However bad a leader he may have been, it did NOT justify the brutal murder of himself and his family.  If a man is guilty of a crime, you put him on trial for said crime.  Of course, thugs and murderers like the Bolsheviks were didn't believe in due process.

Anyway, we're off topic again.  Sorry folks.

Tim, I must respectfully disagree here. Nicholas believed, right up until the end, that he was God's appointed ruler of Russia. Whilst Nicholas adjusted well to his exile, that could be down to his unwavering belief in "God's will" as opposed to coming to terms with the fact he just wasn't cut out for ruling. Had he been offered throne, he would have also seen this as "God's Will" and accepted.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: GD Alexandra on February 26, 2016, 01:34:21 PM
Quick question, I haven't read this book yet. I would like to know if the content is similar to Fate of the Romanovs (regarding the days the IF remained in captivity and the murders) or if it includes new information. I'm aware the authors reach different conclusions, but I'm curious about the facts, or historical accounts.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Sarushka on March 23, 2016, 10:00:35 PM
Quick question, I haven't read this book yet. I would like to know if the content is similar to Fate of the Romanovs (regarding the days the IF remained in captivity and the murders) or if it includes new information. I'm aware the authors reach different conclusions, but I'm curious about the facts, or historical accounts.

It's been quite a while since I read either book, but if memory serves, Resurrection's account of the captivity and murders is basically an abridged version of FOTR's. I don't recall any new information being presented.
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: Kalafrana on March 24, 2016, 03:19:16 AM
Yes. Essentially, that part of the book is 'scene-setting' for the main material, which begins when Fraulein Unbekannt is pulled out of the Landwehr Canal. Before that, there is also some discussion on Anastasia's character, but the meat of the book is very much from 1920 onwards.

Ann
Title: Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
Post by: TimM on March 26, 2016, 07:11:23 AM
Yeah, the gist of the book is how FS became AA.   It's a good read.