Author Topic: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson  (Read 145283 times)

0 Members and 1 Guest are viewing this topic.

Offline Forum Admin

  • Administrator
  • Velikye Knyaz
  • *****
  • Posts: 4665
  • www.alexanderpalace.org
    • View Profile
    • Alexander Palace Time Machine
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #135 on: January 03, 2011, 11:20:03 AM »
Understanding the DNA is important. It really is not "mysterious" or in fact unreliable whatsoever. So, allow me to try to do this simply (even if a little OT, but heck I'm the FA so indulge me):

There are 2 kinds of DNA.  nDNA, or nuclear DNA, which comes from the nucleus of every cell in your body. The original AA test was done with mtDNA, or mitochondrial DNA.  Every person has little bubble of mtDNA in every cell in their body OUTSIDE of the nucleus. mtDNA only comes from the mother, fathers can't pass it along. nDNA changes with every person born.  Mom and Dad each contribute some of their own nDNA to the baby. Some strings of nDNA don't change at all and are the same as the parent that provided it. which is why we can test nDNA for sibling relationships or parental relationships or even Family relationships...Now, mtDNA on the other hand, is very very stable. It only changes, or "mutates" one time in every five generations!! That means, for example, Alixz's mtDNA is the EXACT SAME without variation, as her mother, grandmother, great grandmother, great great grandmother and great great great grandmother!!

That is why mtDNA science can't say for certain WHICH person of those five provided the sample.  BUT, lets us say, Alixz gets an email from someone who says they are her long lost cousin "Zelda" on her mother's side. So, to prove that with mtDNA science we take a sample from Alixz, and a sample from Zelda.

First we look at Zelda's mtDNA. We would see a long string of letters ACTG  in different combinations.  Lets say for example that Zelda looks like this at one point on the strand: ACTGAATGCCAGGTACGAGCT.  We know for certain that Zelda's maternal ancestors for five generations all have the same sequence.

Now we look at the SAME STRAND from Alixz. Her sequence is this: ACTAAACGCCTGGTACGAGCT

Now, we know that for one thing, Zelda's mtDNA can't have been intentionally manipulated in testing. Why? Because it was done FIRST. We had no idea what Alixz's sequence would look like!! We hadn't learned that code yet.

We also know one other thing for certain. Zelda and Alixz aren't related for at least FIFTEEN GENERATIONS! Why?? because mtDNA only makes one change, one different letter, in FIVE generations. Here Zelda has THREE different letters. Three changes means at LEAST Fifteen generations of women before we find a common mother.

Now, what really happened was that AA's mtDNA was sequenced first. We know it can not have been manipulated because ANR's sequence was not yet known.  There were FIVE different letters, or five "mis-matches" between AA and ANR. Just ONE means AA can not have been ANR, but they found FIVE!! No matter how many other pieces of the mtDNA strand they test, those FIVE will always be there.

This explains why we know for certain AA can't have been ANR, but also why we can't say for certain that AA was FS, using mtDNA. 

Is this any clearer? Questions??


 

Offline Kalafrana

  • Velikye Knyaz
  • ****
  • Posts: 2912
    • View Profile
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #136 on: January 03, 2011, 11:47:17 AM »
One point and one question.

mtDNA testing only works with people related EXCLUSIVELY through the female line (whether or not they are female themselves). So the researchers were able to use a blood sample from the Duke of Edinburgh, whose maternal grandmother was Alexandra's sister, to do comparisons with Alexandra herself and her daughters, but the Duke's own children get their mtDNA from the Queen, and back from her through the Queen Mother's female line. As I understand it, finding a suitable person to be a match with Nicholas was more problematical, but the researchers eventually used his brother Georgi Alexandrovich, and the Duke of Fife, who is a female line descendant of Marie Feodorovna's sister Queen Alexandra. Did the researchers use Tikhon Koulikovsky in the end? I understand he was initially very reluctant to be involved.

Now the question. Are the changes every five generations a regular thing, or is this an average? Not that this being an average would invalidate the results.

Ann

Offline Forum Admin

  • Administrator
  • Velikye Knyaz
  • *****
  • Posts: 4665
  • www.alexanderpalace.org
    • View Profile
    • Alexander Palace Time Machine
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #137 on: January 03, 2011, 11:55:58 AM »
The five generations is not an average, it is the actually the fastest it mutates. It might not mutate for 8 or 10 generations, it seems to have never mutated more frequently than five, so they use five as the fastest mutation calculation.  I don't know if Kulikovsky was used or not.

Nicholas II was not identified exactly with mtDNA. He was matched with nuclear DNA from his brother George., and most recently with the Otsu blood stain. They all matched exactly, even down to a rare mutation in one gene. His initial ID was done with Fife. and mtDNA, I believe.

The other point is that all males carry the same mtDNA as their mothers, so male descent can be used as well, which is how FS's nephew provided the mtDNA sample that showed the likelihood of the AA match to FS.


Offline Eric_Lowe

  • Velikye Knyaz
  • ****
  • Posts: 17014
  • I love YaBB 1G - SP1!
    • View Profile
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #138 on: January 03, 2011, 12:00:24 PM »
Well...That is still the Japanese finding that the bones in the mine is not Nicholas II, by using the sweat particules of his long dead brother Grand Duke George and the son of his sister Grand Duchess Olga Alexandrovna. That IS an important finding that Greg King "brushed aside" in his book "The Fate Of The Romanovs" but that finding is DNA based too. You cannot have favour one DNA finding when another DNA finding tells you another. I do not want to comment here, but it seems people here accept that DNA is 100% infallable !  hense I decided to throw this in. If the bones in the mine is not Nicholas II then AA is not FF too. Also do remember that Japanese team had the applause of the Russian Othodox Church who decided to bury the bones as "Christian Saints of the Revolution" rather than as the Imperial Family.

Offline Janet Ashton

  • Knyaz
  • ****
  • Posts: 719
  • www.directarticle.org
    • View Profile
    • Direct Article
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #139 on: January 03, 2011, 12:46:45 PM »
Well...That is still the Japanese finding that the bones in the mine is not Nicholas II, by using the sweat particules of his long dead brother Grand Duke George and the son of his sister Grand Duchess Olga Alexandrovna. That IS an important finding that Greg King "brushed aside" in his book "The Fate Of The Romanovs" but that finding is DNA based too. You cannot have favour one DNA finding when another DNA finding tells you another. I do not want to comment here, but it seems people here accept that DNA is 100% infallable !  hense I decided to throw this in. If the bones in the mine is not Nicholas II then AA is not FF too. Also do remember that Japanese team had the applause of the Russian Othodox Church who decided to bury the bones as "Christian Saints of the Revolution" rather than as the Imperial Family.


You are incorrect - FOTR did not "brush aside" anything. On pages 444-5 it devotes a lot of space to the objections raised in the Nagai tests before concluding that the weight of DNA PLUS historical PLUS anthropological evidence suggests that that bones are those of the Romanovs. You obviously prefer to "brush aside" the anthropological and historical evidence, as well as the rest of the DNA evidence that contradicts Nagai (there's rather more than just one set), whilst insulting those who understand the science for their credulity, and that is your prerogative, but please don't expect your logic to remain unchallenged.

Apparently (and this IS on-topic for the thread) you misunderstand the arguments relating to Ernst Ludwig's purported trip to Russia as well. THe issue of whether it took place or not is hardly the crux of the matter: the argument advanced by AA's supporters was that it was a big secret and if she knew of it she was familiar with high politics. In truth, it was widely spoken of, whether it took place or not, to the point that the German government felt compelled to deny it in 1915, so if she knew of it this proves nothing in her favour. The question is irrelevant in discussion of who AA was or was not. It also makes little sense for Ernst Ludwig to have worried about the trip becoming known, since the sole documentary evidence relating to it (as opposed to reported sightings) is in letters written by the Crown Prince and suggesting that the government mooted it. It did not, therefore, constitute a treason that EL would have needed to hush up. As I have pointed out here in the past, the issue of of far more interest in relation to EL and German politics than Anna Anderson. In her case, it is, as I say, pretty irrelevant.

Please also note that the books "Resurrection of the Romanovs" and "Fate of the Romanovs" were written by Greg King and Penny Wilson - NOT by Greg King solo. To both authors belongs the praise or blame. As Greg posts in this thread perhaps you could address your points to him instead of making these swipes about what you think "King" believes as if you were talking behind his back.
« Last Edit: January 03, 2011, 12:54:54 PM by Janet Ashton »
Shake your chains to earth like dew
Which in sleep had fallen on you -
Ye are many; they are few.

aleksandr pavlovich

  • Guest
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #140 on: January 03, 2011, 01:54:23 PM »
     Re Reply # 145, et al. :  I have read the book, "Carisbrooke, and agree with you, Rob and the others, that the case is closed, door slammed and nailed shut. They are all well and truly dead.  What I particularly prized about King and Wilson, was their documention, even in silly things that have been a bone of contention around here, with the "girlie" fans pussy-footing around the subject of Anastasia's weight near and at the end.  She was NOT merely-overweight, but "fat, dumpy, etc." by documention. If you so chance to see on the various websites photos of themselves , the mosr vociferous of her apologists, note that they too, are certainly carrying their own bit of weight.  I supposed the "passionate ones" try to seize upon a similiatiry to closer identify with their attachment:  "If it's alright for a grandduchess to be 'fat,' then I'm ok, too. Pass the ice cream!"  For those who are attracted to morbity ("EXACTLY HOW did Anastasia die?" has been a discussion on here), there is a sufficient description here, enough to streak their mascara.
     IMO, the value of these two following quotes, are alone worth the price of the book (emphasises MINE):   Page 333  1.)  "Anastasia was an UNREMARKABLE young woman when she stepped across the threshold of that cellar room in the Ipatiev House; it was her rumored survival as Anna Anderson that made her extraordinary."  Then (speaking Of FS), page 334: " And she (FS) has an oddly vocal group of modern critics, THOSE WITH NO CONNECTION TO THE STORY but, who ruled by SENTIMENTAL NOSTALGIA for the vanished Romanovs, disdain the very mention of her name insisting that discussiion somehow insults the memory of the real Anastasia."  Bottom line:  No FS, no AN, other than a footnote that the family perished together. No cartoon, no dolls ("figures"), plastic tiaras, musicboxes, etc.
     The book is well work reading, but I suspect it will not get to the groupies that SHOULD read it, probably being considered too weighty to read and digest.                                              Regards,  AP.
« Last Edit: January 03, 2011, 02:02:36 PM by aleksandr pavlovich »

Offline Forum Admin

  • Administrator
  • Velikye Knyaz
  • *****
  • Posts: 4665
  • www.alexanderpalace.org
    • View Profile
    • Alexander Palace Time Machine
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #141 on: January 03, 2011, 02:21:05 PM »
Well...That is still the Japanese finding that the bones in the mine is not Nicholas II, by using the sweat particules of his long dead brother Grand Duke George and the son of his sister Grand Duchess Olga Alexandrovna. That IS an important finding that Greg King "brushed aside" in his book "The Fate Of The Romanovs" but that finding is DNA based too. You cannot have favour one DNA finding when another DNA finding tells you another. I do not want to comment here, but it seems people here accept that DNA is 100% infallable !  hense I decided to throw this in. If the bones in the mine is not Nicholas II then AA is not FF too. Also do remember that Japanese team had the applause of the Russian Othodox Church who decided to bury the bones as "Christian Saints of the Revolution" rather than as the Imperial Family.

Eric, You don't even have your facts right. "Sweat particules" had nothing to do with it.  The first Japanese test was done on a stain on the handkerchief with Nicholas' blood from Otsu.  This was the original mis match. However, the provenance of the handkerchief indicated that it had been handled my MANY people over the years who could have contaminated it with their own DNA. That is the main reason why it was not as "reliable" as other testing... The next test was done from Nicholas' remains and the remains of Grand Duke George Alexandrovich and they were a PERFECT MATCH! A second retest of the Otsu material came from an identified blood stain and the second test matched Nicholas and George EXACTLY.

Offline Eric_Lowe

  • Velikye Knyaz
  • ****
  • Posts: 17014
  • I love YaBB 1G - SP1!
    • View Profile
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #142 on: January 03, 2011, 02:28:28 PM »
Dear Janet,

I did reread "The Fate of The Romanovs" again. I did NOT see a more scientific comparisons between the results of the Japanese test and the other tests. You cannot simply made a statement (Do remember DNA is a science and not a verdict and need close studying). I did not dispute what conclusion that came to, but not all parts of it was explained as others in great detail. On the Ernie trip on the book, it was also glossed over (not explained in more detail). Yes, it is not as important as the DNA test, but it is another pillar to be knocked down, but it was not done in the same detail as other parts. I don't think it was irrelevent. Also In making these points I am not disputing that AA was not Anastasia or that she might not be FF. I am just listing some points that I find could deal with more in detail. Greg King & Penny Wilson had did a good job in both books and I am the first to applauded that excellent efforts and great grounds that have covered. However it is neither perfect or totally without questions unanswered as Greg had put forth in his foreword. I would love a point to point discussion, but do not want to be drawn onto a black and white argument either you are for or against Greg & Penny. No. It is about facts and how the argument is put forward.

Offline Janet Ashton

  • Knyaz
  • ****
  • Posts: 719
  • www.directarticle.org
    • View Profile
    • Direct Article
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #143 on: January 03, 2011, 05:19:23 PM »
Dear Janet,

I did reread "The Fate of The Romanovs" again. I did NOT see a more scientific comparisons between the results of the Japanese test and the other tests. You cannot simply made a statement (Do remember DNA is a science and not a verdict and need close studying).

I don't need the reminder, thanks.
No, a DNA result is not a "verdict". It indicates a probability, which taken in conjunction with other indicators and evidence inform one's personal opinion. Just as in that chapter of FOTR. I don't understand what further evidence you expected you see. You should be aware that the original FSS tests reached their conclusion based on a number of different perspectives, including the relationship between the individuals in the grave and the relationship with known relatives of the Romanovs. Nagai's result was a wild card which did not challenge the great majority of the FFS results in any way, and the authors were criticized for giving it such attention in the name of openness - they were pretty much accused by some of trying to leave the door "open" for AA to be Anastasia. The irony.

I would love a point to point discussion, but do not want to be drawn onto a black and white argument either you are for or against Greg & Penny. No. It is about facts and how the argument is put forward.

Who is attempting to draw you into such a fatuous discussion? I'm not I hope generally known for "black and white arguments", but for speaking in a direct manner on points of historical discussion.  I don't really care whether you or anyone else is "for or against Greg & Penny" - is this a playground when we all choose our "sides"? I challenge your logic and your evidence and ask you to speak politely in the interests of adult discussion, as a courtesy to the forum owners who have made it clear that this what they want. I have far more interest in Ernst Ludwig than AA, and will have my say on him or any other matter that interests me and is relevant to this thread. They are my personal views. I may agree or disagree with friends or strangers on any topic, but I have certainly never felt the need to abuse someone because I had a different view on some matter of history, still less be part of some internet "gang" on someone's "side". Good grief.
« Last Edit: January 03, 2011, 05:51:31 PM by Janet Ashton »
Shake your chains to earth like dew
Which in sleep had fallen on you -
Ye are many; they are few.

Offline Greg_King

  • Knyaz
  • ****
  • Posts: 588
  • I love YaBB 1G - SP1!
    • View Profile
    • Atlantis Magazine
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #144 on: January 03, 2011, 10:07:02 PM »
If I can try to steer this back to point (and perhaps all DNA questions should go into some new thread in the Myth of Survivors under an FS heading or something):

Originally we did deal with the alleged 1916 trip by Ernie at great length-but it got cut because we had to cut the word count from 160,000 to 140,000. In the end, we agreed that the important point about it was not whether it had taken place or not-it was whether the ALLEGATIONS about it were so secret that AA's mention of them revealed intimate knowledge only Anastasia would have possessed. And as we show, clearly the answer to this was no.

The arguments about the trip belong to another book or issue but seemed ultimately out of place in a book on AA because it was knowledge of the alleged visit, not the visit itself, that was key.

Offline LisaDavidson

  • Moderator
  • Velikye Knyaz
  • *****
  • Posts: 2665
    • View Profile
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #145 on: January 03, 2011, 11:46:15 PM »
And to punctuate Mr. King's point, please stay on topic. Mr. Lowe, discussions of FOTR belong on a different thread, not this one.
« Last Edit: January 04, 2011, 09:56:56 AM by LisaDavidson »

Offline Kalafrana

  • Velikye Knyaz
  • ****
  • Posts: 2912
    • View Profile
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #146 on: January 04, 2011, 03:56:16 AM »
'The five generations is not an average, it is the actually the fastest it mutates. It might not mutate for 8 or 10 generations, it seems to have never mutated more frequently than five, so they use five as the fastest mutation calculation.'

So any genetic link between FS and Anastasia was a minimum 25 generations back, and could be a lot more.

Many thanks for clearing that up.

Ann

Alixz

  • Guest
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #147 on: January 04, 2011, 10:20:52 AM »
FA  Thank you for the explanation.  It had me finally thinking that I understand but then Janet said:

"No, a DNA result is not a "verdict". It indicates a probability, which taken in conjunction with other indicators and evidence inform one's personal opinion" 

That is the kind of statement (and Janet please forgive me, I am not at all slamming you, I am just confused) that does confuse me!

I feel like a complete "dummer Esel" when it comes to all of this.  I am sorry FA, you have done a great job of explaining.

The whole Alixz and Zelda connection made a lot of sense.

« Last Edit: January 04, 2011, 10:23:30 AM by Alixz »

Offline LisaDavidson

  • Moderator
  • Velikye Knyaz
  • *****
  • Posts: 2665
    • View Profile
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #148 on: January 04, 2011, 10:23:38 AM »
Also interesting from an mtDNA standpoint, it seems that the mtDNA found in Franziska's/AA's body is exceedingly rare especially as compared to the so-called Victorian mtDNA shared by female descendants from Queen Victoria, including the Empress and her daughters.

During the 1990's, I was contacted by a family that had paid to have Princess Catherine of Yugoslavia's mtDNA collected and tested because they thought their late mother was a missing Grand Duchess. When it was later claimed that the British crown had manipulated the test results on Prince Philip (the Empress' nephew) and AA, we were able to blow the conspiracy theorists out of the water. Not only was the Duke of Edinburgh's mtDNA sequenced before we knew what AA's mtDNA sequence was, but we had private test results done before the DofE's which exactly matched his and the Empress' - even though all the subjects were of different generations.

Offline Kalafrana

  • Velikye Knyaz
  • ****
  • Posts: 2912
    • View Profile
Re: "Resurrection of the Romanovs: Anastasia, Anna Anderson" by King And Wilson
« Reply #149 on: January 04, 2011, 10:40:34 AM »
"No, a DNA result is not a "verdict". It indicates a probability, which taken in conjunction with other indicators and evidence inform one's personal opinion" 

'That is the kind of statement (and Janet please forgive me, I am not at all slamming you, I am just confused) that does confuse me!'

I think the point is that DNA did not give 'absolute' yes/no results, more that it can show with a very high degree of probability whether, for example, two people are closely related or not. For example (and forgive me if I've got this wrong), the minimum of five generations between mutations means that, with five differences between the mtDNA sequences of Anastasia and Anna Anderson means that there is a very high probability of at least 25 generations between them and any common female-line ancestor.

Taking four generations per century, this puts any putative common ancestor at least 600 years back, to roughly 1300.

Ann