Alexander Palace Forum

Discussions about the Imperial Family and European Royalty => The Final Chapter => Topic started by: Helen_Azar on September 18, 2004, 07:32:10 PM

Title: New study questions identity of Romanov bones
Post by: Helen_Azar on September 18, 2004, 07:32:10 PM
I am not sure if this topic has been posted already, I haven't seen it, but if it has been, please let me know. I recently came across a news article that claims that a new scientific study was performed and found some problems with the DNA results of the Ekaterinburg bones. This study was published earlier this year. Of course my fist thought was "here we go again!" and "where are they getting this from". But I have investigated this farther and have more info, if anyone is interested. In the meantime, here is a copy of this news article:

THE DAILY TELEGRAPH(LONDON)

July 12, 2004, Monday

SECTION: News; International: Pg. 09

LENGTH: 851 words

HEADLINE: Scientists reopen the Romanov mystery An American team challenges DNA-based British research that bodies in a mass grave are the tsar's family, writes Roger Highfield.

BYLINE: by Roger Highfield

BODY:
THE fate of the Russian royal family was plunged into renewed controversy yesterday after scientists cast doubt over British DNA tests on bones recovered from a mass grave.

One of the most riveting detective stories of the past century supposedly ended in 1998, when the Russian government formally declared that the bones were those of the Romanovs, who were executed by the Bolsheviks in 1918.

But in a paper for the seventh International Ancient DNA Conference in Brisbane, a team from Stanford University near San Francisco will this week question tests by Home Office forensic scientists.

Dr Peter Gill and his team at the Forensic Science Service used genetic testing with the help of five cubic centimetres of blood from Prince Philip and other relatives of the Romanovs to announce in 1993 that they
had proved "virtually beyond doubt" that broken bones found in a grave in Yekaterinburg in July 1991 were those of Tsar Nicholas II and members of his family.

The remains were brought to Britain by Dr Pavel Ivanov of the Russian Academy of Sciences and Dr Gill concluded that there was almost a 99 percent probability that five of the nine skeletons were those of the tsar, the tsarina and three of their daughters.

But Dr A. Knight, who conducted the study with colleagues at Stanford, the Russian Academy of Sciences, Eastern Michigan University and Los
Alamos National Laboratory, claimed: "Our team has what appears to be overwhelming evidence to reject the conclusion of the identity of the remains as those of the Russian royal family."

Dr Knight and his team questioned the results, raised "forensic irregularities" and conducted an independent DNA analysis of the preserved finger of the late Grand Duchess Elisabeth - sister of Tsarina Alexandra, one of the 1918 victims.

Since the 1982 opening of Elisabeth's coffin in Jerusalem, the finger had been preserved in a reliquary at the New York home of Bishop Anthony Grabbe, the president of the now-disbanded Orthodox Palestine Society. Crucially, tests on the finger failed to match the tsarina's DNA reported by Dr Gill.

Though Dr Knight's trip was funded by the Russian Expert Commission Abroad - a group of scholars who challenge the assertion that the bones are royal
- he maintains that his experiments were unbiased.

"The commission didn't support the DNA tests or do the science," he said. "They just bought me the plane ticket and got me the sample. They had no control over the work."

Dr Knight argues that the Home Office results were too good to be true and doubts the researchers could have obtained such long stretches of DNA from old bones, particularly those that had spent more than 70 years in a shallow, wet earthen grave.

"Based on what we know now, those bones were contaminated," Dr Knight said, citing strong evidence that the bone samples were tarnished with fresh, less-degraded DNA - from an individual who handled the samples, a claim that is disputed by Dr Gill.

Experts are divided on the issue of DNA preservation. Dr Peter de Knijff, head of the Forensic Laboratory for DNA Research at Leiden University in the Netherlands, agrees that the Gill-Ivanov study was "unrealistically
solid".

But Dr Tom Parsons of the Armed Forces DNA Identification Laboratory in Rockville, Maryland, has found that larger DNA fragments can survive.

Dr Knight said: "We have uncovered irregularities and inconsistencies (and very strange goings-on) in the case, and the results claimed by the DNA tests are essentially impossible.

"We are not questioning the integrity of Dr Gill or Dr Parsons but rather the actions of those in Russia who had control of all the samples, concluded at the outset that they were the royal family, acted with secrecy and deception, distributed the samples to the labs in other
countries, participated in the analyses, wrote a report concluding identity, and then voted on acceptance of that report."

Dr Kevin Sullivan, a casework standards manager at the Forensic Science Service, another of the Home Office team, said: "We have every confidence in our results which have been reproduced and independently confirmed by two other world-renowned DNA laboratories.

"We were able to conclude that the remains were those of the Romanovs because they match the DNA of known living maternal relatives of the tsar and tsarina, including Prince Philip, all of which were analysed after the results were generated from the bones." He added: "The DNA result generated from the shrivelled finger is different to that of Prince Philip and therefore could not have come from the Grand Duchess Elisabeth or any other maternal relative."

The Stanford team's initial findings were reported in the January-February issue of the Annals of Human Biology but were dismissed at the time by Dr Gill, who told the journal Science that Dr Knight's research "comes across
as vindictive and political".

But Dr Knight said the case against the original analysis had strengthened since the paper in the Annals. "Calling us names, as Dr Gill has done, will not help their fatally flawed position."

LOAD-DATE: July 12, 2004


I was wondering if anyone else has heard about this and what your thoughts are, and I can later share more about this...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 18, 2004, 07:51:52 PM
Oh yeah, this story has been out for a while. Interesting, but one of the obvious concerns is that a member of the "team of scholars" is actually a Romanov claimant, with a very specific agenda (he wants to be Tsar).

The fact that certain scientists allowed such a claimant to add his name to their journal article is interesting, also.  Kind of taints the whole project.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 18, 2004, 08:08:04 PM
"Interesting, but one of the obvious concerns is that a member of the "team of scholars" is actually a Romanov claimant, with a very specific agenda (he wants to be Tsar). "  That is very interesting,  Dashkova, I didn't know that! How did you find that information out?
I was very interested to find out what this was all about, and after reading his scientific paper, I wrote to Dr Knight, the guy who did this study, questioning his assertions very thoroughly. Below is the email I sent him... He did reply and I can post that later because I think this post will get truncated otherwise...

Helen


Dear Dr Knight,

Thank you very much for your reply and the paper attachment. I read it and have a few questions that I hope you will take the time to answer.  
First, I would like to say that you have a valid point when you question the length of the mtDNA segments recovered by Peter Gill's lab. But might there be another explanation for this result besides the contamination theory? I realize that finding such large segments would be unusual with older DNA, but is it completely impossible? Is it not possible that Gill retrieved his samples from a desiccated portion of the remains where longer pieces of DNA might have survived? Perhaps Gill himself has a good explanation for this result and I was wondering if you spoke to him about this before you published your work? I will write to him as well and inquire about this.  
The reason I am questioning the contamination theory is because, in my opinion it is extremely hard to believe that the contaminated DNA sequence would match the Duke of Edinburgh's mtDNA exactly, I just don't think this can happen from random contamination. Yes, mtDNA is not as precise as nuclear DNA, but chances are extremely slim that a "random someone" with the same mtDNA as Prince Philip accidentally contaminated these samples while handling them. So if contamination is the culprit here, the only logical explanation would be that the samples were deliberately contaminated with known "fresh" DNA that belonged to someone whose DNA sequence is identical to Prince Philip's. And if this was the case, wouldn't Peter Gill have realized that these results were not the ones you would expect to get with ancient DNA? Or do you suspect that Gill was aware of this and ignored it, or was actually a part of the deliberate contamination?  These scenarios sound so far fetched, and this is why I think that there has to be another explanation than the one you offer.
The second point I wish to raise is that a major part of your argument against the Ekaterinburg bones is based on your finding that the DNA extracted from the finger, presumed to be Grand Duchess Elizabeth's, did not match the Gill DNA sequence. First, I was wondering if this finger was actually attached to the body that was presumed to belong to Elizabeth when it was recovered from the mineshaft, or was it just found next to it and was assumed to belong to the body? Also, which finger was it, was it from the left or the right hand, and was that consistent with the hands on the body? Is there any scientific proof that the finger belongs to the Grand Duchess Elizabeth? I know that various church members testified as to its authenticity but, while I respect the church members' beliefs, I would like to know if there is any scientific proof that this identification was genuine? Humans make mistakes all the time, as you are well aware. It seems that you are making the assumption that the initial identification and the subsequent chain of custody f Elizabeth's body was absolutely unquestionable, but I am not sure that this assumption is valid. I don't think I can accept the icon around the neck as sufficient proof of the body’s identification as Elizabeth.  If the finger really belongs to the Grand Duchess, wouldn't the mtDNA extracted from this finger match that of Prince Philip? How do you explain the fact that it doesn't? You don’t refer to the Duke of Edinburgh’s mtDNA at all in your paper, why? In my opinion, it is one of the most relevant pieces of evidence here.  Is it possible that the Grand Duchess’s body was misidentified initially and it really belongs to the other woman who died alongside the Grand Duchess, the convent novice Varvara Yakovleva? If this finger was not actually attached to the body when it was recovered, can another part of the body presumed to be Elizabeth’s be tested? Where are Varvara’s remains at present time and can they be tested, as they may actually be those of GD Elizabeth.
Lastly, I am sure that you are aware that DNA tests were also done on the bones that presumably belong to Nicholas II, and these results were compared to the DNA of the tsar's exhumed brother, Grand Duke George. The DNA sequences matched exactly, both sets even exhibited the same heteroplasmy. Are these results being questioned as well, or is the contention that Nicholas's remains are genuine but the rest of the bones in the Ekaterinburg grave belonged to random victims other than the former imperial family?
Dr Knight, your technical expertese in the lab is thorough and rigorous, but it seems that your paper has many selective omissions of any and all information that goes against your own theory about the Ekaterinburg bones. When these bones were identified as belonging to the Romanov family ten years ago, this judgment was not made solely upon Peter Gill's DNA evidence, although that was a big part of it. Many other things were taken into consideration including historical, anthropological, sociological and biological aspects. Arriving at a multi-disciplined, consistent scenario is the only way to approach something like this. I understand that your main concern here is with the molecular aspects, but even so, your own research has not provided sufficient scientific proof (or I should say disproof) from that angle, in fact, it invoked even more serious questions. If you have suitable explanations to my three main questions, I am prepared to accept your conclusions, but as it stands right now, I am more than a little skeptical.
In conclusion, I would like to ask what you think the next logical step in this research should be?
Thank you again for your time and I look forward to your reply.
Sincerely,

Helen A

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 18, 2004, 09:29:44 PM
Hi Helen,

If you'd like to talk about this, send me a private message.

Ditto for anyone else who is interested.
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 19, 2004, 11:12:34 AM
 I cannot believe that Dr Gill would call anyone "names" -he is too much of a gentleman for that sort of thing!

R.
Title: Re: New study questions identity of Romanov bones
Post by: AGRBear on September 19, 2004, 03:03:34 PM
I for one am interested in what Dr. Knight replied.

AGRBear
Title: Re: New study questions identity of Romanov bones
Post by: Michelle on September 19, 2004, 05:35:31 PM
Me too! :D
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on September 19, 2004, 07:24:16 PM
I agree with Michelle - and I daresay all interested in the case would be interested in Dr. Knight's response. Is it possible to post this? I'd also like to ask him why he permitted a claimant with an agenda on his team? To me, it really taints the whole objectivity of the paper, no?
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 19, 2004, 11:57:07 PM
Quote
"
The second point I wish to raise is that a major part of your argument against the Ekaterinburg bones is based on your finding that the DNA extracted from the finger, presumed to be Grand Duchess Elizabeth's, did not match the Gill DNA sequence. ... Is there any scientific proof that the finger belongs to the Grand Duchess Elizabeth?

Is it possible that the Grand Duchess’s body was misidentified initially and it really belongs to the other woman who died alongside the Grand Duchess, the convent novice Varvara Yakovleva?
Helen A

 


helen,

These are interesting developments indeed!

After reading the original Knight paper, the most glaring question which I posed to myself related to the authenticity of G. D. Elizabeth's remains. Thanks for bringing up this issue in the manner in which you did.

If there are surviving relatives from Varvara Yakovleva's family who would be willing to participate in having a DNA profile undertaken, we would have at least drawn one unexpected conclusion, while opening the door to another ...

It would certainly go a long way to explain why Knight was unable to achieve any compatibility with 'his' sample.

If it was possible, I would welcome reading any reply Knight has made regarding your e-mail to him. Thanks in anticipation. :D

To have a 'claimant' on Knight's team certainly raises the question of how much impartiality was involved in achieving the interpretations he reached. Not a wise move ...  :o
 
Title: Re: New study questions identity of Romanov bones
Post by: Olga on September 20, 2004, 03:55:32 AM
Quote
I'd also like to ask him why he permitted a claimant with an agenda on his team? To me, it really taints the whole objectivity of the paper, no?


I agree. Makes the whole exercise seem shady and biased.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on September 20, 2004, 10:24:17 AM
Hold on to your horses everyone...true, there seems 'something' wrong with having a claimant on the Knight team yes! But is there any indication that Dr. Knight's research was biased? Are the results phony?, wrong?, or untrue? I don't think we can say that just yet.

His criticism/study of Dr. Gill's work may have been initiated by partison inclinations  nevertheless his conclusions..i.e. 'Fresh Blood added to Dr. Gill's study in order to achieve perfect results' has been upheld by other well known geneticists....I don't remember their names but I'm sure I could find out if necessary.
Title: Re: New study questions identity of Romanov bones
Post by: Martyn on September 20, 2004, 12:45:44 PM
This controversy looks set to run and run.  Might I just ask this question - what will happen if they prove that the bones that have been buried with all due solemnity are not in fact those of the IF?
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on September 20, 2004, 12:56:22 PM
Quote
This controversy looks set to run and run.  Might I just ask this question - what will happen if they prove that the bones that have been buried with all due solemnity are not in fact those of the IF?



That is a very interesting question,I was wondering the same thing.I am also very interested in Dr. Knight's response.
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 20, 2004, 01:13:50 PM
Now, don't also forget there is a third option here. Gill's testing "may" have been indeed bad, BUT the remains are still the IF, and there is other evidence. Bad work by Gill does not per se exclude these remains as genuine, it just means the tests were bad.

Now, I know y'all are going to ask, BUT don't, we really cannot go into detail, but this is appearing to be the case. Our source is impeccible, and someone known to Greg, Penny, Peter, Lisa etc as reliable...but I can not nor will not reveal more as we were instructed not to at this time.

Just keep this thought in mind.
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on September 20, 2004, 01:22:38 PM
Ooooh FA you shouldn't have done that. :D
Now we will all be waiting impatiently until you are able to spill what you know and who you learned it from.I guess I can wait patiently,but man it's gonna be hard.
:) ;D :D ;)
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 20, 2004, 09:45:26 PM
The conclusion which Knight et al. drew was that the relic sample allegedly removed from G.D. Elizabeth finger was profiled, and it was that DNA profile which did not correlate with the DNA which came from Alexandra.

The issue here is not whether the I. F. have been correctly identified.

The presumption is that Knight's experimental sample actually came from G. D. Elizabeth. The original chain of custody of a body from the time female remains were found, allegedly identified as those belonging to G. D. Elizabeth, and placed into the correctly labelled coffin, followed by its transportation from Siberia to Shanghai may be the problem.

If those remains belonged to the accompanying nun Vavara, and not to Elizabeth, then any compatibility tests conducted will never provide the expected result.

Knight's methodology is not questioned, nor are the results which he obtained. One must under the circumstances question the authenticity of the sample given to the Stanford laboratory.  
Title: Re: New study questions identity of Romanov bones
Post by: JonC on September 20, 2004, 10:08:34 PM
I would like to accept this idea that

'the bones are real but the tests were bad' position.

I just hope this doesn't end up like President Bush's forged documents. i.e. the documents were forged but what they say is true idea.

If the documents were forged   then whatever they were saying is totally of no consequence/ made up/ hearsay.

Similarly if the tests on the bones were untrue then how on earth are they still belonging to the Romanov's?
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on September 20, 2004, 11:43:31 PM
What I believe without question is that the mtDNA taken from Prince Philip and others matches the mtDNA of some of the remains found in the grave.

I also believe the presence of a pretender with an agenda draws Knight's work into question.

I will leave the rest to the scientists.
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 21, 2004, 12:48:35 AM
Quote
What I believe without question is that the mtDNA taken from Prince Philip and others matches the mtDNA of some of the remains found in the grave.

I also believe the presence of a pretender with an agenda draws Knight's work into question.


Lisa, I concur on both counts!

The use of mtDNA provides a more definitive assessment. The advantage of using mitochondrial DNA sequencing  unlike chromosomal DNA, is that it degrades more slowly. Therefore this form of typing is a more accurate method of profiling, and is the better procedure for geneticists to examine older samples.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 22, 2004, 02:45:11 PM
Hi guys, sorry I didn't reply before this but I haven't had the chance to get on the site lately. Lisa, I agree with you 100%, I wish I knew about this pretender prior to my letter to Knight, because I would have most certainly asked him about that one too! But in any case, I did want to give him the benefit of the doubt about all this, as is only fair. I am posting Knight's reply and my own reply to his. I was not very happy with his reply and I feel that he is being evasive - he could have answered some of my questions without violating confidentiality, but he chose not to... In any case, here is his reply:

Dear Helen,
Your evaluation of the case and your questions are completely logical and understandable, given your information. We are about to publish additional
information that will help to answer some of your questions. Until this next paper is published, unfortunately I am not at liberty to discuss these
issues, but I most certainly will very soon, after we are published. THEN you will begin to understand! Please be patient--you shouldn't have to wait very long. I apologize for being seemingly cryptic, but soon you shall
understand. I looked at your web site and found it very nice and interesting. How did you come to be involved it the case of the Romanovs?

I can say now with more assurance than ever, those Ekaterinburg remains are not those of the Royal Family! Until recently, I, along with other members
of our team, allowed for the small possibility that they were the Romanovs, but given my present knowledge, I don't think that is possible. I am a 'total evidence' person, and this conclusion comes from all evidence. DNA
is only a part of it.

Please be understanding and patient with my situation.
Regards,
Alec



Dear Alec,

As you can probably imagine, I am disappointed by your response. I understand very well about research confidentiality but I was hoping to at least get the answers to my secondary questions that directly relate to your current study, such as the source of your positive control DNA (the finger). I am very eager to see your next paper in which I expect you to address the obvious omissions in your previous analysis. I believe what's hurting your investigation is the lack of forthrightness, and I really want to be surprised by the quality of your next work.

In answer to your own question, I am not really involved in the Romanov case at all. I just happened to come upon the Daily Telegraph article that referred to your research, wanted to know more about it, and read your paper. I also read Gill's paper and a few others relating to all this and came up with these questions. Since I understand both the history and the science behind all this, I find it fascinating and would like to finally get all the facts straight (which, as it turns out, is a very daunting task). I don't particularly have any preference as to whether these bones should belong to the Romanovs or not, I just want to find out the facts. I am not exactly sure why this case has become so convoluted, this should have  been a case of identifying some historical remains, no more no less, but it seems to have escalated to the proportions of international conspiracy. I am sure this mostly has to do with some sort of politics.

By the way, the website you are referring to, was it the page on the Alexander Palace website where they posted the pictures of my recent visit to Russia? This is the only thing I can think of, as I don't have my own website.  

Well, thanks again for taking the time to write to me. I am certainly going to be looking forward to your next paper. When do you expect to publish it, do you think it may be in the next six months or so?

Regards,

Helen Azar

Quote
What I believe without question is that the mtDNA taken from Prince Philip and others matches the mtDNA of some of the remains found in the grave.

I also believe the presence of a pretender with an agenda draws Knight's work into question.

I will leave the rest to the scientists.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 22, 2004, 02:53:04 PM
Belochka, yes! yes! This was exactly the main point of my letter to Knight. His science is not under question here, he did a very good job in fact. The questions are what are they using as a point of reference and why are they ignoring some very crucial historical and scientific evidence?  
Quote

The presumption is that Knight's experimental sample actually came from G. D. Elizabeth. The original chain of custody of a body from the time female remains were found, allegedly identified as those belonging to G. D. Elizabeth, and placed into the correctly labelled coffin, followed by its transportation from Siberia to Shanghai may be the problem.

If those remains belonged to the accompanying nun Vavara, and not to Elizabeth, then any compatibility tests conducted will never provide the expected result.

Knight's methodology is not questioned, nor are the results which he obtained. One must under the circumstances question the authenticity of the sample given to the Stanford laboratory.  

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 22, 2004, 03:01:39 PM
Rob, I was thinking the same thing actually, as I think it would be too far fetched if the remains end up not belonging to the IF! I actually tried to find Gill's email address so I could write to him also and ask him some questions, but would you believe that his contact info is not listed in any of his publications! This is highly unusual. I did write to one of his colleagues to see if he can give me Gill's address but never heard from him.... But I am sure we will find out soon enough what's going on here.
Quote
Now, don't also forget there is a third option here. Gill's testing "may" have been indeed bad, BUT the remains are still the IF, and there is other evidence. Bad work by Gill does not per se exclude these remains as genuine, it just means the tests were bad.


Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 22, 2004, 03:04:35 PM
I believe Dr Gill said something to the effect of "the Stanford research is rubbish", and this is what they meant  by calling names  :D
H
Quote
I cannot believe that Dr Gill would call anyone "names" -he is too much of a gentleman for that sort of thing!

R.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 22, 2004, 03:22:26 PM
Excellent question, Martyn!

Helen

Quote
 Might I just ask this question - what will happen if they prove that the bones that have been buried with all due solemnity are not in fact those of the IF?

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 22, 2004, 06:46:15 PM
One more thing... Stanford University has a webpage on their website that talks about the Romanov bone controversy. They are obviously taking this seriously!

http://news-service.stanford.edu/news/2004/march3/romanov-33.html
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 22, 2004, 06:52:50 PM
Hi Helen,

Thanks very much for providing Knight's reply and your forwarding reply. We now must patiently wait for the follow-up paper.

It is encouraging to note that Knight found this site. I only hope that he will be open to other suggestions concerning the lack of compatibility between the reference sample and that believed to belong to I.F.

Perhaps it may be worthwhile to consider a couple of questions:

1. Since there was incompatibility between tested samples, could there be other factors involved?

2. Is there any remote possibility that the reference material is not what it is purported to be?


Until there are answers to these fundamental questions, there can not be absolute certainty that the results obtainted by the Stanford laboratory can be accepted unconditionally, without any perception of bias.

While we can see the direction where Knight's revelations appears to be heading, it would not be meritorious to make specific claims when doubts remain.

With respect, this door is not closing, it remains open wider than originally anticipated ...  :o

Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 22, 2004, 07:19:49 PM
Quote
This controversy looks set to run and run.  Might I just ask this question - what will happen if they prove that the bones that have been buried with all due solemnity are not in fact those of the IF?


Martyn,

No matter how this issue will be resolved, I firmly believe that the ceremonial and spiritual symbolism which took place in SPb in 1998, and witnessed by the Romanov family, was a vital process which formally acknowledged the fate of the last I.F. and their retainers.

Let us not forget that some hold doubts about the final resting place of Alexander I as well.
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on September 22, 2004, 07:56:02 PM
That was a very informative article Helen.Thank you for posting it. :)
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 22, 2004, 08:21:33 PM
Hi Belochka,

I was wondering what you mean by "other factors involved"? Do you mean contamination or something else? And by "reference material" do you mean the positive control DNA they used, i.e. DNA from the finger? In my opinion, this finger does not belong to GD Elizabeth. If the finger was really Elizabeth's it's mtDNA would have matched Prince Philip's mtDNA, or else Prince Philip is not who he claims to be! Or are they proposing that his DNA was planted? I am not really sure what they are proposing at this point and no one involved with this study is answering any questions. But I am certainly very curious to see how all this plays out!
My personal theory is that somewhere along the way the Alapaevsk bones got all mixed up and the remains they thought were Elizabeth's actually belong to Varvara, her novice, who I believe was the only other woman who died in that mineshaft. And, unless this finger wasn't attached to the body when they found it, this means that the remains or the relics, as the case may be now, do not belong to Elizabeth either. This puts the church in a funny position because if this is the case, then all these years they have revered the wrong relics! Unfortunately, as you can see, Dr Knight will not even answer basic questions about this finger and what condition it was found in. Maybe you also noticed when you were reading Knight's paper, that when he refers to the purported IF remains, he calls them just that "purported", but whenever he makes a reference to the finger, he always says "the finger that belongs to Elizabeth" without bothering to call it "purported". So he is obviously assuming that the identity of the finger has been established 100%, but where is the scientific proof? Did you read the part where they describe how they actually identified Elizabeth's body when they initially found it? I couldn't believe it! So many holes in all this, but why are these assumingly reputable scientists going along with all that? Not to mention the "claimant to the throne" involved in this investigation that I only found out about yesteday, now what is that all about? And the university is putting up webpages about this case on their website! This is all very strange.  

Helen

Quote
Hi Helen,


1. Since there was incompatibility between tested samples, could there be other factors involved?

2. Is there any remote possibility that the reference material is not what it is purported to be?



 

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 22, 2004, 10:52:45 PM
Dear Helen,
Your evaluation of the case and your questions are completely logical and understandable, given your information. We are about to publish additional
information that will help to answer some of your questions. Until this next paper is published, unfortunately I am not at liberty to discuss these
issues, but I most certainly will very soon, after we are published. THEN you will begin to understand! Please be patient--you shouldn't have to wait very long. I apologize for being seemingly cryptic, but soon you shall
understand. I looked at your web site and found it very nice and interesting. How did you come to be involved it the case of the Romanovs?

I can say now with more assurance than ever, those Ekaterinburg remains are not those of the Royal Family! Until recently, I, along with other members
of our team, allowed for the small possibility that they were the Romanovs, but given my present knowledge, I don't think that is possible. I am a 'total evidence' person, and this conclusion comes from all evidence. DNA
is only a part of it.

Please be understanding and patient with my situation.
Regards,
Alec

****************
Many thanks to Helen for posting Alec's response.  Does anyone else find it interesting that a scientist would actually use the phrase:  "this conclusion comes from all evidence, DNA is only part of it."

This is not the way scientists write, this is not the way they think.  I think this "response" was written by someone other than Alec Knight, and then sent to Helen.


Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 22, 2004, 11:15:41 PM
Hi Helen,

To answer your first set of questions, the queries which I posed were my keyboard thoughts, the answer if affirmative for the first one should have flowed fairly easily onto the second question.

While Knight's team questions the chain of custody belonging to Alexandra's sample, including the archeological and forensic violations which certainly did occur, he does not question the chain of custody regarding Elizabeth's sample.

You very cleverly highlighted the precise wording which Knight et al. used to differentiate the relic sample from those which were 'assumed' to belong to Alexandra. The article's 'Introduction' immediately attempted to create doubts in the mind of the reader concerning the authenticity of Alexandra's sample.

Why not permit the assays to be carried out in a neutral laboratory in a blind study, avoiding any perception of bias?

Only after the incompatible result was attained, can further questions be raised seeking all plausible explanations why such result had came about. To my mind, and yours, there is more than one possible explanation, and it does not accord with the one which Knight obtained.

I agree with you that to identify Elizabeth's remains many months after the event on the basis of the presence of an icon on the body certainly does create a degree of uncertainty. We cannot exclude the possibility that Elizabeth felt that her female companion Varvara deserved the honor of wearing that special icon, in death or while she was still alive. Furthermore, the transportation of the remains from location to location can present significant chain of custody issues.

Please let us know when you hear anything further.

All the best!

Belochka  ;)

Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on September 22, 2004, 11:22:14 PM
I agree that whoever is responding to these questions is no scientist - it is probably the person with the agenda. If that's true, this will be a scandal for the university.
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 23, 2004, 12:02:52 AM
Dashkova,

With respect, we will never be able to ascertain who wrote the e-mail. It would be presumptious to believe that scientists write in a particular set style. We all have our own techniques in the use of the English language.

It would be difficult to believe that Knight et al. would compromise their standing within the scientific community. This is a public domain, as are the contents of any transmitted e-mail. If such an e-mail was written by another person claiming to be Alec Knight, then there is a real need for concern here. :o

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 12:27:24 AM
I have been in communication with Alec Knight in the past. He doesn't write like that.

The claimant he has listed on his paper *does*.

To borrow your little phrase:  "With respect," I must tell you that I am somewhat more informed about this, and about some of the people involved in the new "research."

As to "never being able to know who wrote..." again you are mistaken.  If Helen has the headers from that email, we can find out *quite* a bit about the sender.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on September 23, 2004, 07:32:46 AM
Since discussions on Dr. Knight's research appeared on this web site I took the liberty of calling him on the telephone. To my amazement he answered the phone. Anyway I was surprised, also, with his responses.

When I asked him how he felt about all the other pretenders even one in particular that we have had on this web site he was adamant in his belief that 'his' claimant's photos were the absolute best he had seen. He IS convinced, that whoever he knows IS the true claimant.

Even though his research seems reliable to us I am beginning to think he will conform whatever he does to fit the pattern of HIS claimant.

Unfortunately, this has been the pattern from other claimants. What makes Dr. Knight more dangerous is that he is trying to blind us with his 'Science'. I hope I'm wrong.
Title: Re: New study questions identity of Romanov bones
Post by: Inquiring_Mind on September 23, 2004, 07:57:21 AM
Good morning all,

Forgive my ignorance, but who is Dr Knight's claimant?

Susie
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 23, 2004, 08:31:24 AM
I should also like to know this.

R.
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 23, 2004, 08:48:50 AM
The person who used to post here as "Rodger", Daryll Litwin, who "mysteriously" stopped posting once his involvement became known.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 09:05:23 AM
How did you guys find out the true identity of Rodger (i.e.) Daryl Litwin? And did he actually claim to be a Romanov descendant right here on the forum? I missed his posts and only saw comments of others about him here. I couldn't find any info about him anywhere else, like Google, so is this a secret claim? This whole thing is getting weirder and weirder by the minute!

H

Quote
The person who used to post here as "Rodger", Daryll Litwin, who "mysteriously" stopped posting once his involvement became known.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 09:17:02 AM
Hi JonC,

How very interesting, so you actually spoke to Alec... This is what I figured, that he actually does believe in all this and that this is his motivation behind doing the research. Did you ask him if he did any DNA tests on Litwin? Is that what makes him so sure? I believe, based on his track record so far, that you are right, he will conform any and all of his data to fit his theory, as he did in his last paper with "the finger".... Dr Knight is not "blinding us" with anything, as so far, he has not done anything earth shattering, at least nothing that a competent molecular biology tech couldn't have done. His methods and techniques are good but everything else needed to complete the picture is totally missing.... He has not provided any scientific proof to his claims and will not answer any questions, even basic ones....  
Quote
Since discussions on Dr. Knight's research appeared on this web site I took the liberty of calling him on the telephone. To my amazement he answered the phone. Anyway I was surprised, also, with his responses.

When I asked him how he felt about all the other pretenders even one in particular that we have had on this web site he was adamant in his belief that 'his' claimant's photos were the absolute best he had seen. He IS convinced, that whoever he knows IS the true claimant.

Even though his research seems reliable to us I am beginning to think he will conform whatever he does to fit the pattern of HIS claimant.

Unfortunately, this has been the pattern from other claimants. What makes Dr. Knight more dangerous is that he is trying to blind us with his 'Science'. I hope I'm wrong.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 09:27:05 AM
Dashkova, here is the full email again, with the header:

Date: Fri, 17 Sep 2004 09:09:18 -0700
From: "Alec Knight" <Ralph.Knight@asu.edu>  Add to Address Book
Subject: Re: 'Annals of Human Biology' paper
To: "Helen" <mushkah@yahoo.com>

   
Dear Helen,
Your evaluation of the case and your questions
are completely logical and
understandable, given your information.  We are
about to publish additional
information that will help to answer some of your
questions.  Until this
next paper is published, unfortunately I am not
at liberty to discuss these
issues, but I most certainly will very soon,
after we are published.  THEN
you will begin to understand!  Please be
patient--you shouldn't have to wait
very long.  I apologize for being seemingly
cryptic, but soon you shall
understand.  I looked at your web site and found
it very nice and
interesting.  How did you come to be involved it
the case of the Romanovs?

I can say now with more assurance than ever,
those Ekaterinburg remains are
not those of the Royal Family!  Until recently,
I, along with other members
of our team, allowed for the small possibility
that they were the Romanovs,
but given my present knowledge, I don't think
that is possible.  I am a
'total evidence' person, and this conclusion
comes from all evidence.  DNA
is only a part of it.

Please be understanding and patient with my
situation.
Regards,
Alec

Quote
As to "never being able to know who wrote..." again you are mistaken.  If Helen has the headers from that email, we can find out *quite* a bit about the sender.

Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 23, 2004, 09:41:52 AM
Helen,
The information about Rodger was sent to us by several sources, both wholly reliable.  Not wanting to reveal them, I simply asked Rodger in a private email if he knew a fellow Phoenix resident named Daryl Litwin. That was the day he disappeared from the forum.
FA
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 09:48:41 AM
Thank you, Rob. This is so bizarre!! How did Knight and Zhivotovksy get involved with this guy???  ???

Quote
Helen,
The information about Rodger was sent to us by several sources, both wholly reliable.  Not wanting to reveal them, I simply asked Rodger in a private email if he knew a fellow Phoenix resident named Daryl Litwin. That was the day he disappeared from the forum.
FA

Title: oRe: New study questions identity of Romanov bones
Post by: rskkiya on September 23, 2004, 09:57:10 AM
Helen

  Members sometimes delete their old posts- hence posts may mention a person although that individuals remarks are no longer evident...

  Regarding "Rodger" no doubt only he or the FA could have remove posts. ( I never thought much of that gentleman... then again I used to be a guest here and often posted politically dubious things too! ;))

Regards
the often naughty
Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 10:20:36 AM
Quote
Since discussions on Dr. Knight's research appeared on this web site I took the liberty of calling him on the telephone. To my amazement he answered the phone. Anyway I was surprised, also, with his responses.

When I asked him how he felt about all the other pretenders even one in particular that we have had on this web site he was adamant in his belief that 'his' claimant's photos were the absolute best he had seen. He IS convinced, that whoever he knows IS the true claimant.

Even though his research seems reliable to us I am beginning to think he will conform whatever he does to fit the pattern of HIS claimant.

Unfortunately, this has been the pattern from other claimants. What makes Dr. Knight more dangerous is that he is trying to blind us with his 'Science'. I hope I'm wrong.



Wow, Jon, this is *stunning*. Thank you so much for making that call.  Even though I'm stunned, I'm not *too* surprised.  I remember two years ago when Litwin told me that he thought he had "convinced" Alec about his claim and that Alec had now framed photos of the IF in his home (I know many of us do, but he began to do this based on his contact with the claimant).

*Then,* in the fall of 2002, when I was in communication with author Shay McNeal (who also was in touch with Alec and knew Lev Zhivotovsky) I told Shay that Litwin was sure that Alec et al were convinced of his claim.  Shay immediately spoke with Alec about this and then he emailed Litwin a scathing response, stating that "your claim is interesting, but we don't have all the facts."  In fact, Litwin was so upset by this email he gave me a copy of it to see if I thought he should be worried about the future of the project (rather, his involvement with it).

Looks like Mr. Con-Artist Litwin has fooled at least one Stanford scientist.  This is just amazing to me.  If you knew the claimant personally, you could better appreciate my amazement.
Wow.
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on September 23, 2004, 10:22:32 AM
What is the point of this excercise in the first place ?
It is surely unlikely that the legitimate family Romanove [either side of the fence], well documented public and semi-public people, will welcome with open arms ANOTHER long lost relative.
There is absolutely no wisp of a throne to aspire to, even IF there were some sort of credible monarchist movement afoot in Russia itself.
There is no fabled fortune waiting to be claimed, by ANYONE.
Whoever Dr. Knight's "claimant" is, will undoubtebly be met with no little amount of sceptisim if not downright ridicule.
And if that Rodger fellow IS involved, the whole operation is obviously a charade.
What a waste of time, money and talented resources needed elsewhere in the world community.
Best,
Robert

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 10:23:34 AM
Helen, thanks for reposting the email. However, I would need the *full* headers, and this was not posted.

And of course, we could find out more about the sender, not necessarily the author.

After what JonC has posted, I am thinking that maybe Alec did write it after all.  If so, he is brainwashed to the point that he writes almost exactly in the same style as the claimant (something I personally did not observe before).
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 10:25:28 AM
Quote
What is the point of this excercise in the first place ?
It is surely unlikely that the legitimate family Romanove [either side of the fence], well documented public and semi-public people, will welcome with open arms ANOTHER long lost relative.
There is absolutely no wisp of a throne to aspire to, even IF there were some sort of credible monarchist movement afoot in Russia itself.
There is no fabled fortune waiting to be claimed, by ANYONE.
Whoever Dr. Knight's "claimant" is, will undoubtebly be met with no little amount of sceptisim if not downright ridicule.
And if that Rodger fellow IS involved, the whole operation is obviously a charade.
What a waste of time, money and talented resources needed elsewhere in the world community.
Best,
Robert



Once again, brilliantly stated Robert.
Title: Re: New study questions identity of Romanov bonesw
Post by: AGRBear on September 23, 2004, 10:30:02 AM
I was busy watching the interum-Prime Minister of Iraq this morning so I missed the Today show.

Did anyone see it?  

Meanwhile,  Helen has caused this old Bear to click on a Stanford web site.  It was tuff but I did manage.  Puting my bear humor aside,  since Stanford is almost as good as CAL,  I read the article and find it very interesting.  

Keeping an open mind in bear territory  ;D.

AGRBear
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 10:37:30 AM
Dashkova, I am not really sure what you mean by a "full" header", let me know where to find it and I will be happy to post it...
Moving right along, I believe that Alec is the one who wrote this email as I don't think we can really judge by it's tone or style as to what group of people the author belongs to (scientist or someone else). Many people use the same style of writing. But yes, Alec certainly seems to have been convinced, or to use your expression "brainwashed" , or else he really does have some compelling evidence.... I want to stay open-minded about this, but not ridiculously so...

Helen


Quote
Helen, thanks for reposting the email. However, I would need the *full* headers, and this was not posted. And of course, we could find out more about the sender, not necessarily the author.

After what JonC has posted, I am thinking that maybe Alec did write it after all.  If so, he is brainwashed to the point that he writes almost exactly in the same style as the claimant (something I personally did not observe before).

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 10:45:23 AM
The full header of an email contains the sender's ISP address and other potentially useful info. All you have to do in most accounts is click on the "full header" button within the email document, and then the full info appears.

Knowing what I know about the individuals in question, I must say the very idea that a serious scientist would actually state he believes this claimant is the "real McCoy" is creepy.

That this appears to be what has actually happened is sickening.

I can certainly understand the "keep an open mind" bit.  But the rest of you (as far as I know) have not seen what I have seen, and heard and experienced.  My mind is not closed.  It's just better informed.

Please know that I would have been extremely grateful to have been FAR less well-informed.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 11:03:54 AM
Ok, thanks, Dashkova. Here it is:

X-Apparently-To: mushkah@yahoo.com via 66.218.93.38; Fri, 17 Sep 2004 09:09:41 -0700
X-Originating-IP: [129.219.110.120]
Return-Path: <ralph.knight@asu.edu>
Received: from 129.219.110.120 (EHLO post5.inre.asu.edu) (129.219.110.120) by mta110.mail.sc5.yahoo.com with SMTP; Fri, 17 Sep 2004 09:09:41 -0700
Received: from conversion.post5.inre.asu.edu by asu.edu (PMDF V6.1-1X6 #30769) id <0I4700H010VJBP@asu.edu> for mushkah@yahoo.com; Fri, 17 Sep 2004 09:09:19 -0700 (MST)
Received: from smtp.asu.edu (smtp.asu.edu [129.219.110.107]) by asu.edu (PMDF V6.1-1X6 #30769) with ESMTP id <0I4700GG20VIII@asu.edu> for mushkah@yahoo.com; Fri, 17 Sep 2004 09:09:19 -0700 (MST)
Received: from [149.169.133.165] ([149.169.133.165]) by smtp.asu.edu (8.12.10/8.12.10/asu_smtp_relay,nullclient,tcp_wrapped) with ESMTP id i8HG9I71020742 for <mushkah@yahoo.com>; Fri, 17 Sep 2004 09:09:18 -0700 (MST)
Date: Fri, 17 Sep 2004 09:09:18 -0700
From: "Alec Knight" <Ralph.Knight@asu.edu>  Add to Address Book
Subject: Re: 'Annals of Human Biology' paper
In-reply-to: <20040916232516.54700.qmail@web41208.mail.yahoo.com>
To: "Helen" <mushkah@yahoo.com>
Message-id: <BD705A3E.5AEA%aknight@stanford.edu>
MIME-version: 1.0
Content-type: text/plain; charset=US-ASCII
Content-transfer-encoding: 7bit
User-Agent: Microsoft-Entourage/11.0.0.040405
Content-Length: 643

Hey, even not knowing what you know seems really weird that a serious scientist would get involved in all this. This is what makes it so unbelievably weird!  But what is it that you know? And is another paper with "proof" really about to be published, as Knight claims?

H
Quote
Knowing what I know about the individuals in question, I must say the very idea that a serious scientist would actually state he believes this claimant is the "real McCoy" is creepy.

That this appears to be what has actually happened is sickening.

I can certainly understand the "keep an open mind" bit.  But the rest of you (as far as I know) have not seen what I have seen, and heard and experienced.  My mind is not closed.  It's just better informed.

Please know that I would have been extremely grateful to have been FAR less well-informed.

Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 23, 2004, 11:13:41 AM
I am a little confused here. I thought Alec Knight was at Stanford University. The email originated at Arizona State University (I checked the originating ISP:149.169.133.165) and the email address is even Ralph.Knight@asu.edu, which again is Arizona State.
Is Alec Knight at ASU or Stanford??? Did I miss something, or do I smell a rat?
FA
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 11:23:58 AM
Oh FA, you are SO brilliant.  I just ran the ISP through my software too and came up with the same results.

Alec, last time I checked, was at Stanford.

Litwin, however, is in Phoenix (last I heard, from a reliable source).  He is also a graduate of ASU, with a bachelor's in.....Psychology.  

Yes.  I said, psychology...lol.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 11:27:00 AM
Hey, when I initially emailed Alec, I used a different email address, the Stanford one. Yes, the reply came back from a different address, but it didn't even occur to me to question it. So, what does this mean? [And what now?  :o

H
quote author=Dashkova link=board=family;num=1095550330;start=50#53 date=09/23/04 at 11:23:58]Oh FA, you are SO brilliant.  I just ran the ISP through my software too and came up with the same results.

Alec, last time I checked, was at Stanford.

Litwin, however, is in Phoenix (last I heard, from a reliable source).  He is also a graduate of ASU, with a bachelor's in.....Psychology.  

Yes.  I said, psychology...lol.[/quote]
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 11:27:29 AM
Helen, as I've already posted, I checked out the ISP and got the same results.

As for what I know, I have messaged you about some of this.  If you want more, I will write again later today.  What would be helpful is that in light of what I've told you, what questions do you have, specifically?
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 11:31:55 AM
What does it mean?

Let me answer first with another question: Can you understand now why I refused to back pedal about the author of the email?

Ok, I backpedaled a bit due to JonC's apparent conversation with Alec.  But still, the whole thing did not come across as being written by Alec Knight; rather it was remarkably written in "Litwin Style"

I think this means that the claimant has contacted you himself! Lucky you!  ;)

But the rest of us should probably cheer up.  I would be extremely surprised if said claimant isn't lurking and watching this right now!

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 11:36:16 AM
Yes, it would be great if you could answer some questions.
Was "Rodger" claiming on this site that he is the Anastasia descendant? Which Anastasia is that? Was it Anna Anderson? Is his claim a secret one, because there is no information about this guy anywhere else on the internet? This whole thing is so bizarre. It is unimaginable to me that a serious scientist, and more than one, would get involved in a cockamamie research like this unless there was some compelling evidence! Or is Litwin impersonating these scientists? This is very surreal, and what a can of worms! Please tell us as much as you can, so we can make sense of this. I am sure I am speaking for many others. Thanks!

Helen

Quote
Helen, as I've already posted, I checked out the ISP and got the same results.

As for what I know, I have messaged you about some of this.  If you want more, I will write again later today.  What would be helpful is that in light of what I've told you, what questions do you have, specifically?

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 11:39:57 AM
So you are saying that Alec Knight forwarded my email to Litwin and Litwin replied, impersonating Alec Knight? Why??? If this is really true, no wonder his email came off so unprofessional... Why is Alec Knight putting his professional reputation on the line like this for this guy? Does he not realize that he will be finished as a scientist if this gets out? I don't get it.  ???

Helen

Quote
What does it mean?

But still, the whole thing did not come across as being written by Alec Knight; rather it was remarkably written in "Litwin Style"

I think this means that the claimant has contacted you himself! Lucky you!  ;)




Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 23, 2004, 11:45:10 AM
My suspicion is that Litwin lurks reading the site, and simply replied to you pretending to be Dr. Knight... Your email address is available publicly.
I suspect but cannot prove that Jon C. might be Litwin. Best I can find out, Jon C. uses both Earthlink and RoadRunner from Herndon Virginia to post, and a yahoo email account.
Title: Re: New study questions identity of Romanov bones
Post by: Annie on September 23, 2004, 11:45:18 AM
Maybe he doesn't realize his email was used by the claimant via the forward! Maybe the claimant deleted what the doctor really said and replaced it with his own writings, but left the doctor's info on there to try to make it look official ???
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on September 23, 2004, 11:53:36 AM
I hope someone contacts the real Dr. Knight. AFAIK, "Rodger" was Litwin, the claimant with an agenda.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 12:03:09 PM
Quote
My suspicion is that Litwin lurks reading the site, and simply replied to you pretending to be Dr. Knight... Your email address is available publicly.
I suspect but cannot prove that Jon C. might be Litwin. Best I can find out, Jon C. uses both Earthlink and RoadRunner from Herndon Virginia to post, and a yahoo email account.



I kind of had/have the same suspicions.  I might be stating the obvious here, but I just consulted with a computer scientist I happen to live with, and was told that Earthlink and Roadrunner (just like AOL) route all their accounts through Herndon, VA, but the actual origin of the account holder will not be displayed.

Perhaps JonC would like to clarify a few things?
Title: Re: New study questions identity of Romanov bones
Post by: Michelle on September 23, 2004, 12:08:23 PM
Wow you guys!  This is REALLY CREEPY!!!! :o
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 12:11:36 PM
Helen wrote:
Yes, it would be great if you could answer some questions.
Was "Rodger" claiming on this site that he is the Anastasia descendant?

**To the best of my knowledge, no.

Anastasia is that? Was it Anna Anderson?

**Not Anderson. His own personal Anastasia, rescued possibly along with her entire family by Hetman Skoropadsky and others.  Wound up in Michigan (apparently Henry Ford was involved in this, perhaps FDR too...and oh, yeah, Elvis) then finally in Phoenix...where she worked as a house maid~! (Hey, I've seen photos of that!)

Is his claim a secret one, because there is no information about this guy anywhere else on the internet?

***He likes to keep people guessing.  Enjoys dropping broad, loaded hints.  Eventually tells all if he thinks it will benefit him in some way (particuarly financially).

This whole thing is so bizarre.
***Yep. You have no idea!

Or is Litwin impersonating these scientists?

***Can't say with total certainty, but it's starting to look that way.


PS:  The Elvis part was me being facetious.  But, he kind of fits in with the pattern, wouldn't you say?  Maybe aliens, too?
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 12:20:46 PM
Forgot to add...regarding your question about his need for secrecy.

Well. You realize that certain evil forces would be actively searching out and destroying any *true* Romanov claimants, right?  (this is what he ardently believes).

It was not at all uncommon, while I knew him, to hear reports that the KGB and the Illuminati were hot on his tail.

In fact, he eventually accused me -- and my family -- of being agents of the above named organizations.  I've still got the emails, those he sent to me, and also those he sent to members of his family (they later forwarded copies to me).

So, you know, with all us deadly secret agents after him, a guy can't be too careful.
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on September 23, 2004, 12:25:14 PM
Sounds to me like a tired old parlour game devised to fool gullible little old ladies out of their life savings. As well as gullible anyone who would fall for this nonsense.
I do not know this Rodger/Litwin personally, just from this site. However, he sounds like he probably operates on other sites with other names. Whether or not he is the same person, the story is remarkably the same- missing heir=missing fortune waiting to be claimed. Of course, the whole plot takes time to convince  people, with all the "credentials" at hand.
If the REAL Romanov family distance themselves from this sort of scam, why should any of us fall for it?
There are better returns from some Nigerian bankers available, I keep passing those up as well, however.
Cheers,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: JonC on September 23, 2004, 12:48:12 PM
Hold it!!!! FA, nope, I'm not 'Litwin'. I am simply JonC. Scout's honor...and I'm not holding crossed fingers behind my back. lol.

Com'on now I already posted my suspicions about Dr. Knight's intentions after my phone call with him.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 12:56:54 PM
But FA, I got this reply from Alec Knight way before I posted any of this on AP site, so how would that be possible? How would he know that I wrote to Alec Knight whose address I got directly from the Stanford website. I don't think so.

Helen

Quote
My suspicion is that Litwin lurks reading the site, and simply replied to you pretending to be Dr. Knight... Your email address is available publicly.
I suspect but cannot prove that Jon C. might be Litwin. Best I can find out, Jon C. uses both Earthlink and RoadRunner from Herndon Virginia to post, and a yahoo email account.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 01:02:56 PM
Wait a minute, are you  saying that Litwin is publishing papers under these scientist's names?? Because it is obvious from the papers themselves that the authors really believe in this, in which case why would he need to impersonate them?
If Rodger didn't claim to be the "descendant" here on this forum, then where did he claim it? It is not found anywhere on the internet....

Quote
Helen wrote:
Yes, it would be great if you could answer some questions.
Was "Rodger" claiming on this site that he is the Anastasia descendant?

**To the best of my knowledge, no.

Anastasia is that? Was it Anna Anderson?

**Not Anderson. His own personal Anastasia, rescued possibly along with her entire family by Hetman Skoropadsky and others.  Wound up in Michigan (apparently Henry Ford was involved in this, perhaps FDR too...and oh, yeah, Elvis) then finally in Phoenix...where she worked as a house maid~! (Hey, I've seen photos of that!)

Is his claim a secret one, because there is no information about this guy anywhere else on the internet?

***He likes to keep people guessing.  Enjoys dropping broad, loaded hints.  Eventually tells all if he thinks it will benefit him in some way (particuarly financially).

This whole thing is so bizarre.
***Yep. You have no idea!

Or is Litwin impersonating these scientists?

***Can't say with total certainty, but it's starting to look that way.


PS:  The Elvis part was me being facetious.  But, he kind of fits in with the pattern, wouldn't you say?  Maybe aliens, too?

Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 23, 2004, 01:04:26 PM
To JonC. I apologise if you are not involved. We have had a few too many imposters here, who use untraceable ISPs.
To Helen, perhaps the only answer then is that 'somehow' Dr. Knight let it be known to others about your question here. The only real answer of course, can come from Dr. Knight himself.
My suspicions are still on "Red" level alert...
FA
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 01:05:52 PM
Lisa,

Litwin is one of the secondary authors on the Knight paper, so I am pretty sure Knight knows him and is in full support of him. Unless you guys are implying that Litwin is doing all the research and writing the papers and adding these scientist's names as authors for effect? What are you guys talking about?

Helen

Quote
I hope someone contacts the real Dr. Knight. AFAIK, "Rodger" was Litwin, the claimant with an agenda.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 01:08:55 PM
Robert, what you say is all very logical and I agree with you, but can you explain how a team of scientists from Stanford got involved in all this nonosense and even allowed this guy to put his name on their research paper? That's the part I am having trouble with....

Helen

Quote
Sounds to me like a tired old parlour game devised to fool gullible little old ladies out of their life savings. As well as gullible anyone who would fall for this nonsense.
I do not know this Rodger/Litwin personally, just from this site. However, he sounds like he probably operates on other sites with other names. Whether or not he is the same person, the story is remarkably the same- missing heir=missing fortune waiting to be claimed. Of course, the whole plot takes time to convince  people, with all the "credentials" at hand.
If the REAL Romanov family distance themselves from this sort of scam, why should any of us fall for it?
There are better returns from some Nigerian bankers available, I keep passing those up as well, however.
Cheers,
Robert

Title: Re: New study questions identity of Romanov bones
Post by: Annie on September 23, 2004, 01:13:18 PM
Quote
If Rodger didn't claim to be the "descendant" here on this forum, then where did he claim it? It is not found anywhere on the internet....



He deleted most of his posts :-/
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 01:15:02 PM
...publishing papers under these scientist's names??


***I'm sorry Helen, but where in what I have written do you see the suggestion that he is publishing anything under someone else's name?  *His* name is one of the names on the journal article we're talking about.

Because it is obvious from the papers themselves that the authors
***He is one of the authors, but bear in mind that the article does not put forth Litwin's claim, it merely disputes the authenticity of the remains.


really believe in this, in which case why would he need to impersonate them?

**My guess, and this is just a guess, is that Alec fields all (or at least some) of the Romanov enthusiast queries to Litwin.

Is your email address displayed in your profile here? Has it ever been?  This would be one way he could obtain your contact information. Or, as I suggested before, Alec could have forwarded your letter to him and let him handle the questions.  This, of course, indicates trust on the part of the scientist.  Nobody ever said that scientists can't be fooled, certainly at least one is in this case.
__________________
If Rodger didn't claim to be the "descendant" here on this forum, then where did he claim it? It is not found anywhere on the internet....

**Does his claim have to appear on the internet?  Do you want a list of people I know of whom he has told?  I can't tell you every single place/person to whom he has made the claim, but I do know of several, including myself and members of my family.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 01:16:48 PM
Quote

He deleted most of his posts :-/



Yes, he did.  It was more than 200 at one point, most deleted on a single day.  Isn't it interesting how it was Rodger who began the Imperial Claimants Thread? Surprise! He had everyone fooled into believing he was joking!
Title: Re: New study questions identity of Romanov bones
Post by: Annie on September 23, 2004, 01:20:14 PM
Quote

 This, of course, indicates trust on the part of the scientist.  Nobody ever said that scientists can't be fooled, certainly at least one is in this case.


I know our first instinct is to respect all scientists, but there must be a reason for the old term 'mad scientist' ;)

It could be, if this scientist really is involved, that he doubts it but wants to check everything out on the remote chance that it would be true, then he would go down in history! And  speaking of history, while someone may be brilliant in science they may be uninformed on history, or at least aspects of Russian history that would prove to them that this story is most unbelieveable.
Title: Re: New study questions identity of Romanov bones
Post by: Annie on September 23, 2004, 01:22:18 PM
Quote


Yes, he did.  It was more than 200 at one point, most deleted on a single day.  Isn't it interesting how it was Rodger who began the Imperial Claimants Thread? Surprise! He had everyone fooled into believing he was joking!


:o That's awful! That's the main reason I am for limiting the amount of time a poster may delete or modify their posts (some other boards I'm on make posts permanent after giving you an hour to change your mind ) Don't post anything you might consider evidence you want to destroy later! ;)
Title: Re: New study questions identity of Romanov bones
Post by: Lanie on September 23, 2004, 01:23:37 PM
Just to comment about this Litwin fellow--he's been around on some of the boards I've been on and has spouted his crazy theories to me.

This is getting beyond ludicrous to me.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 01:26:23 PM
Well, there is obviously something "not right" with Knight's email origin, so of course I am willing to accept that he may have forwarded my email to Litwin and allowed him to answer it. I guess this is what you guys meant when you said that he is "impersonating" Knight (sorry Dashkova, I thought you meant something else).  
But fact remains, is that apparently the whole research team was taken in by this Litwin character, who according to all descriptions is nothing more than a babbling idiot. Of course no one is claiming that scientists are the sharpest knives in the drawer when it comes to stuff like this, but at the same time, all these people believe Litwin? So this means either all of them are extremely gullable, or this guy Litwin has gotten a lot better at his act, or he actually had some compelling evidence to show them that made all involved buy into this...
You see what I mean?

Quote
To JonC. I apologise if you are not involved. We have had a few too many imposters here, who use untraceable ISPs.
To Helen, perhaps the only answer then is that 'somehow' Dr. Knight let it be known to others about your question here. The only real answer of course, can come from Dr. Knight himself.
My suspicions are still on "Red" level alert...
FA

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 01:28:18 PM
Annie wrote:
And  speaking of history, while someone may be brilliant in science they may be uninformed on history, or at least aspects of Russian history that would prove to them that this story is most unbelieveable.

You are *precisely* right.  I know that not long after Alec became involved with this, he didn't know much about the IF.  

There's more I would say about where he got some of his information, or rather, *who* pointed him to certain sources (and certain passages in certain books) he might want to consider in learning about the family and the possibilities that the mystery remains unsolved, but I am not going to go there.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 01:32:18 PM
Helen, regarding his "evidence"...Why don't you have a look at some of his photos?  The "royal" ones, naturally.  He gave me some photocopies.  There are some on this board who have already seen them, through email and other sites.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 01:34:35 PM
Helen, I noticed that your email address *is* on your profile here.  all it would have taken was Litwin noticing your original post in this thread and then he could have contacted you about it.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 01:40:04 PM
Yes, that's true, my email address is there, but my original post abou this came way after I got the reply email from Alec Knight. This is what I was saying before to FA....

Quote
Helen, I noticed that your email address *is* on your profile here.  all it would have taken was Litwin noticing your original post in this thread and then he could have contacted you about it.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 01:42:12 PM
Oh I'm not saying that I believe that this guy has the evidence, I am just playing the devil's advocate and saying this could have been one of the options. I personally don't know what to think! Where can I see these photos?

Quote
Helen, regarding his "evidence"...Why don't you have a look at some of his photos?  The "royal" ones, naturally.  He gave me some photocopies.  There are some on this board who have already seen them, through email and other sites.

Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on September 23, 2004, 01:58:35 PM
Just because Litwin is on the author's credits of the magazine article does not necessarily mean that eveyone else  there BELIEVES him. He may have contributed some way, materials, financing, anything to have that credit. [liason to the poor, uninformed masses who may DOUBT ?]
My partner's business  is always getting credit for things  like fundraisers when they actually provided some props.
It just seems the season again for these things, we have this 105 y/o Anastaia again ? Some mysterious filmaker touting her cause to the tune of "outrageous" fortune.
A new Rasputin murderer ?
What surprises me the most is that people actually pay these things so much attention, when they should be simple curiosities, diversions when bored.
Cheers,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 23, 2004, 02:20:12 PM
Found this in a more complete story about the Stanford study, explaining how Litwin got involved:
"About three years ago, Daryl Litwin, an author of the Knight et al. paper who was studying law in Sacramento, proposed to Knight the idea for a re-analysis of the Gill-Ivanov data after reading Robert Massie's book The Romanovs: The Final Chapter. ''I just kept finding contradiction and discrepancy from point to point,'' Litwin said. ''I was left kind of befuddled.'' Before approaching Knight, Litwin discussed his ideas with a Russian history expert at the Hoover Institution at Stanford, who agreed that the Romanov verdict was worth re-examining. "
http://www.eurekalert.org/pub_releases/2004-03/su-ssq030204.php

Also, now it gets more odd. Dr. Knight's full name is: Ralph Alexander Knight.
Could he be temporarily at ASU?

However, the Knight paper does NOT in any way advocate anyone else as the "relative". It simply casts doubt on the accuracy of the 1993 work by Dr. Gill.
too many smoke and mirrors for me.
Title: Re: New study questions identity of Romanov bones
Post by: Annie on September 23, 2004, 02:33:44 PM
Maybe they thought if they mentioned a claimant it would discredit the whole thing ;)
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on September 23, 2004, 02:48:00 PM
This whole thing is just too weird. :o
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 02:51:46 PM
Rob, yes I did know that knight's complete name is "Ralph Alexander", I looked at his CV while I was corresponding with him to see exactly who this guy is. This is why it didn't strike me as strange that his email address had "ralph" in it. I guess it is possible that he is at Arizona U, maybe they are doing a collaboration there, it is not unusual. I can try to find out.....
H
Quote
Also, now it gets more odd. Dr. Knight's full name is: Ralph Alexander Knight.
Could he be temporarily at ASU?


Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 02:52:41 PM
Ummm....yeah!!   :P

Quote
This whole thing is just too weird. :o

Title: Re: New study questions identity of Romanov bones
Post by: Inquiring_Mind on September 23, 2004, 03:01:40 PM
On Stanford's website Dr Knight is listed as a senior research scientist. Others on the site have bios and pictures when you click on their names Whenyou click on Knight's name it brings up some files. One file is named Grand Duchess Elizabeth. It is a picture of I believe Dr Knight  on left and another man, Knight pointed to a computer screen?? Strange.

http://www.stanford.edu/~aknight/GrandDuchessElizabeth/Discovery.jpg
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on September 23, 2004, 03:09:39 PM
I am with FA on this circus act.
In the same Stanford article by Esther Landhuis it mentions that ...Knight's trip was funded by the Russian Expert Commission Abroad". Who is this ?
Also "They just bought me the ticket and provided the sample..."
Well now, if someone paid my cab fare and bought me dinner, would I not drink his wine?
Another mention is made of an Orthodox Palestine Society. [now disbanded].
Litwin's sole contribution to all this seems to be reading the Massie book, discussing his "ideas" with a Russian history expert at the Hoover Inst. who agreed the Romanov verdict worth re-examining [un-mnamed].
None of this adds up to even some of our least creative fiction on the family, so far.
Until something more interesting arises...
Cheers,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: haleycopter on September 23, 2004, 04:10:26 PM
Wow, very interesting.  And fishy.  But I didn't really have to say that.   ;)  I guess the truth will be revealed by time, if you guys don't uncover it before time does!  
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 04:31:50 PM
Quote
On Stanford's website Dr Knight is listed as a senior research scientist. Others on the site have bios and pictures when you click on their names Whenyou click on Knight's name it brings up some files. One file is named Grand Duchess Elizabeth. It is a picture of I believe Dr Knight  on left and another man, Knight pointed to a computer screen?? Strange.

http://www.stanford.edu/~aknight/GrandDuchessElizabeth/Discovery.jpg


That's Zhivotovsky, at the moment of their "discovery"
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 04:34:21 PM
Quote
Just because Litwin is on the author's credits of the magazine article does not necessarily mean that eveyone else  there BELIEVES him. He may have contributed some way, materials, financing, anything to have that credit. [liason to the poor, uninformed masses who may DOUBT ?]


All true.  I just wonder why it did not occur to the real scientists on the article that having a claimant (overt or otherwise) listed as a contributor would look rather suspicious.
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 23, 2004, 05:17:19 PM
Daskova

As I remember "Rodger" was always complaining about the "innaccurate" DNA tests ...but he never wanted to elaborate on this issue... He rather made out that he was quite the expert and that it was all too technical for the rest of us as I recall.

This is all too Cloak and Dagger for me.


R.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 05:34:16 PM
Quote
Daskova

As I remember "Rodger" was always complaining about the "innaccurate" DNA tests ...but he never wanted to elaborate on this issue... He rather made out that he was quite the expert and that it was all too technical for the rest of us as I recall.

This is all too Cloak and Dagger for me.


R.


Yes.  One of his posts actually stated that he was/is a graduate student of molecular biology or dna studies, etc, and he continued to string people along that he had a scientific background.

He does not.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 05:35:35 PM
Cloak and dagger in the sense of...well, more like...
Cheese and crackers.  Playing at big secrets that are absolutely meaningless.
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 23, 2004, 05:42:39 PM
 Cheese and Crackers! Brilliant !

I do feel special-- as I too was accused of being a member of the One World Government /KGB /Interpol /Freemasonic conspiracy out to get him!

Wow! I guess I did have an agenda after all!

LOL (menace menace)
R :)
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 05:58:46 PM
LOL!! ;D

I just wanted to let those of you who were interested know that I am working on putting the photos somewhere that they can be seen.

I thought I had figured it out but it's not working, on this site or another one I set up quickly.  I will have to work on it later.

Some of the photos can be viewed at the yahoo group RomanovMysteryClub but they are not completely labeled there.  I'm pretty sure anyone can look at the photos without joining the club.

I still have other photos that I have never scanned, but will try to do so over the next week or so.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 06:08:38 PM
According to ASU's website directory, "Ralph Knight" is a visiting student:


Name: Knight, Ralph
E-mail: Ralph.Knight@asu.edu
Affiliation: Visiting Student


Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 06:21:12 PM
Well, that explains it then. No mystery there, he must just be taking a course over there, possibly online, and that's why he has the Arizona U email address. So I am back to the opinion that those responses were really from Knight and not from the mysterious Daryl Litwin. To be perfectly honest, I wish I could have seen some of Litwin's postings that everyone is talking about, so I could judge for myself what he is all about.... Too bad they are no longer here. I think that's always best to see things first hand, because things tend to get twisted through various interpretations.  

Quote
According to ASU's website directory, "Ralph Knight" is a visiting student:


Name: Knight, Ralph
E-mail: Ralph.Knight@asu.edu
Affiliation: Visiting Student



Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 06:30:43 PM
Sorry to add more to this, but look....

The ISP address comes from where the computer is located that is being used to send the email.

In other words, when I was in Russia last spring, and used my school email account (in Russia, at an internet cafe), the ISP that showed up on the email my family received was in Russia, NOT back home.

So, Alec is in Arizona and Palo Alto at the same time, hmmm?

Not to mention the Litwinesque writing method employed by the composer of the email in question.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 07:22:01 PM
Robert,

As a scientist and an amateur historian, I like to look at and take into consideration all evidence, no matter how strange it sounds, before I completely dismiss it. This will ensure that nothing important is ever overlooked.

Another thing that I want to point out to you, is that as far as I am aware, scientific publications have different criteria for co-authorship than humanities papers: generally the co-author would have to supply some sort of scientific contribution to the research in order to be named as co-author, and anyone whose name appears on the paper, particularly the first author, is taking responsibilty for what this paper says, hence putting his professional reputation on the line. If Litwin was only a contributor in the form of supplying them with historical info or something like that, then he would have been mentioned in the acknowledgements or the citations (if he ever published anything) but not as a co-author. Anything is possible of course, but I never heard of that being the case. I don't think we should just dismiss all this before we even know enough about it. We should look at all this in a rational way, ask some rational questions, hopefully get some answers, and then make our judgment in whether we should dismiss this or wait for additional information or accept it as fact. But everyone operates in different ways, so whatever you choose to do is the right way for you...

Helen

Quote
Just because Litwin is on the author's credits of the magazine article does not necessarily mean that eveyone else  there BELIEVES him. He may have contributed some way, materials, financing, anything to have that credit. [liason to the poor, uninformed masses who may DOUBT ?]
My partner's business  is always getting credit for things  like fundraisers when they actually provided some props.
It just seems the season again for these things, we have this 105 y/o Anastaia again ? Some mysterious filmaker touting her cause to the tune of "outrageous" fortune.
A new Rasputin murderer ?
What surprises me the most is that people actually pay these things so much attention, when they should be simple curiosities, diversions when bored.
Cheers,
Robert

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 07:35:30 PM
So what are you saying?  :-/

Quote

The ISP address comes from where the computer is located that is being used to send the email.

In other words, when I was in Russia last spring, and used my school email account (in Russia, at an internet cafe), the ISP that showed up on the email my family received was in Russia, NOT back home.

So, Alec is in Arizona and Palo Alto at the same time, hmmm?

Not to mention the Litwinesque writing method employed by the composer of the email in question.

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 07:55:00 PM
Ok.  The most recent email you received from "Alec" was *sent* to you *from* a computer at Arizona State University.  This was discovered by tracing the ISP on the email header.

Nowhere on the Stanford website is there listed something along the lines of "Alec Knight on sabbatical"  He works at Stanford.  Which is in California. Fall semester is underway so if he still works there and *isn't* on leave, the email should have come from Stanford.

We definitely know that Litwin is in Arizona, and that the email is written in a style that is highly evocative of Litwinese (I'll send you some samples).

Would you mind posting the full headers from the first email Alec sent?  

Oh, I thought it might also be interesting to note that the address Alec lists on his Stanford "profile" is the exact same post office box used by Litwin when he was living in California.

Maybe these guys like to share stuff...mailboxes, email accounts, etc.  Who knows what else?

And now, as fascinating as this is, I've got to get back to work!  No more cheese and crackers at least for a few hours.
Title: Re: New study questions identity of Romanov bones
Post by: pushkina on September 23, 2004, 08:02:21 PM
how does this new study refer to the studies cited in the interviews of olga nikolaevna kulikovsky-romanov?  in her interviews in the road to emmasu, she seemed adamant in her view that the studies which defintiely certified the bones were fraudulent.

this rodger person issue aside, could her (olga's) scientists and their processes actually yield better/more credible/important results?
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 08:11:16 PM
Dear Dashkova,

I do understand all that stuff about the location of the computer, but you don't really think that Litwin registered as a visiting student at Arizona U as Alec Knight, do you?  ??? I know you didn't actually say this, but this is what it seems to imply, or am I reading too much into this?

It's amazing that you still remember Litwin's PO Box address from a couple of years ago, considering that I usually have trouble remembering my own address from a couple of years ago!  ;D

Guys, I just don't want to start seeing "conspiracy behind every bush" before I get all the facts straight, and everyone is being so mysterious with their "secret sources" and "information that no one else knows but me". Dashkova, you gave me some interesting info to ponder on, and I appreciate that, but I still have not really heard anything to make me completely dismiss all this without at least hearing more from the other side.

Sure, I will post the full header from the other email he sent me...

This message is not flagged. [ Flag Message - Mark as Unread ]

X-Apparently-To: mushkah@yahoo.com via 66.218.93.37; Tue, 14 Sep 2004 08:32:08 -0700
X-Originating-IP: [129.219.110.120]
Return-Path: <ralph.knight@asu.edu>
Received: from 129.219.110.120 (EHLO post5.inre.asu.edu) (129.219.110.120) by mta135.mail.sc5.yahoo.com with SMTP; Tue, 14 Sep 2004 08:32:08 -0700
Received: from conversion.post5.inre.asu.edu by asu.edu (PMDF V6.1-1X6 #30769) id <0I4100601F2DKF@asu.edu> for mushkah@yahoo.com; Tue, 14 Sep 2004 08:30:14 -0700 (MST)
Received: from smtp.asu.edu (smtp.asu.edu [129.219.110.107]) by asu.edu (PMDF V6.1-1X6 #30769) with ESMTP id <0I41004OQF2CV4@asu.edu> for mushkah@yahoo.com; Tue, 14 Sep 2004 08:30:13 -0700 (MST)
Received: from [149.169.133.165] ([149.169.133.165]) by smtp.asu.edu (8.12.10/8.12.10/asu_smtp_relay,nullclient,tcp_wrapped) with ESMTP id i8EFUB71014248 for <mushkah@yahoo.com>; Tue, 14 Sep 2004 08:30:11 -0700 (MST)
Date: Tue, 14 Sep 2004 08:30:11 -0700
From: "Alec Knight" <Ralph.Knight@asu.edu>  Add to Address Book
Subject:  Re: Daily Telegraph
In-reply-to: <20040913021819.58570.qmail@web41203.mail.yahoo.com>
To: "Helen" <mushkah@yahoo.com>
Message-id: <BD6C5C94.59D6%aknight@stanford.edu>
MIME-version: 1.0
Content-type: multipart/mixed; boundary="Boundary_(ID_tDbElqzlbCICgmdCfMds5Q)"
User-Agent: Microsoft-Entourage/11.0.0.040405
Content-Length: 115249

   
Dear Helen,
I have attached a PDF of our original paper and
perhaps that will answer
your questions.
Regards,
Alec
**************************************
Alec Knight, Ph.D.
Senior Research Scientist
Department of Anthropological Sciences
450 Serra Mall, Bldg. 360 Main Quad
Stanford University
Stanford, CA 94305-2117
**************************************



Quote
Ok.  The most recent email you received from "Alec" was *sent* to you *from* a computer at Arizona State University.  This was discovered by tracing the ISP on the email header.

Nowhere on the Stanford website is there listed something along the lines of "Alec Knight on sabbatical"  He works at Stanford.  Which is in California. Fall semester is underway so if he still works there and *isn't* on leave, the email should have come from Stanford.

We definitely know that Litwin is in Arizona, and that the email is written in a style that is highly evocative of Litwinese (I'll send you some samples).

Would you mind posting the full headers from the first email Alec sent?  

Oh, I thought it might also be interesting to note that the address Alec lists on his Stanford "profile" is the exact same post office box used by Litwin when he was living in California.

Maybe these guys like to share stuff...mailboxes, email accounts, etc.  Who knows what else?

And now, as fascinating as this is, I've got to get back to work!  No more cheese and crackers at least for a few hours.

Title: Re: New study questions identity of Romanov bones
Post by: AGRBear on September 23, 2004, 08:21:49 PM
Helen and others,

When I first joined this discussion board,  I was told I was not me because a few thought I was Rodger.  Since I am not Rodger  I couldn't help but wonder how in the world they came up with this  idea.  So I posted that I was not Rodger. The responce amazed me.  I was told I was a lier....    Finally, the forum admin. had to step in and tell everyone I couldn't be Rodger.

What I'm trying to say is:  Don't jump to  conclusions.  Sit back, take a deep breath.   Tomorrow,  one of you call Stanford.  Someone there will let you know if you can reach Dr. Knight by phone or e-mail.   If he is no longer part of the Stanford staff then they will send you where you can make contact.  Once he is reached then you can ask him if he wrote to Helen.  His answer will be either he did or he didn't.  Simple.  Worth the effort and this eliminates all these speculations I've just wadded through.

Who knows,  maybe,  he can give you information on Rodger.

AGRBear  
Title: Re: New study questions identity of Romanov bones
Post by: Inquiring_Mind on September 23, 2004, 08:55:47 PM
Dashkova,

I'd be interested in seeing the pictures you mentioned if you find the time to post them....thanks
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 09:04:49 PM
AGRBear, you're absolutely right!  I hope someone will call and see just what's up with Dr. Knight.  It probably won't be me, since it seems he is so enamored with the claimant he is liable to believe I am ringing him up from KGB headquarters  ::)  

I was just wondering, JonC, when you called Alec Knight, was it the cell phone number that is listed on the Stanford site? Or did you call Stanford directly.

Helen, I don't know what to say.  What more can I tell you?  I am absolutely not hiding anything or in possession of secret knowledge. All of this (from my end of the story) happened two years ago.  This is the first time I have spoken about it publicly.  I am happy to share what I know, and am the first to say that I do not know it all about any of this!

Did I encounter this "claimant"?  You bet I did!  Do I still have documentation from him dealing with his claim, his pursuit, copies of photos he says are his Romanov relatives? Yes!  Have I seen the rest of his pathetic evidence? Yes! Do you know the creep still has some of his bills sent to my address?  Including his car payment!  I still regularly hear from "advance payday" companies seeking him for non-repayment of loans and student loans, too. I've got scads of email from one of his family members detailing the now seven-year long "Tsar Quest".

I know of at least one author, not a favorite in these parts, but an author nonetheless, Shay McNeal, who knows quite a bit about Litwin's claims.

I've got a book's worth of info here about this whole story.  I do not have the time to relate every single conversation, and bit of info that was imparted to me.  You, too are a scholar, so please understand where I'm coming from.  I have a severe time shortage, a ton of projects, and a household to run.

As I have time I will point you to the copies of photos I have, and I will even forward to you emails that he sent directly to me, to the FA of this website, to and *from* Alec and others.  I won't be doing it tonight, I'm sorry!  It's just too much, and since it was an overall bad experience (even losing money in the form of unpaid loans I made to His Wasteproductness), you can imagine it's not something I like to spend a lot  of time thinking about!

I wish there was a way I could just put it all in a folder for all who wanted to see it, but for now, think what you like, I don't think it matters either way, except that I suspect a great many people will not hold the "new research" in such high regard when they understand a claimant is part of the team.

Best regards,
Dashkova
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 23, 2004, 09:07:39 PM
Quote
Dashkova,

I'd be interested in seeing the pictures you mentioned if you find the time to post them....thanks


A few of the pictures were posted on a yahoo groups website, romanovmysteryclub.  I checked earlier and unfortunately one has to join the group in order to view the photos. There's two there of the supposed Anastasia and one of the supposed GD Mikhail A.  Yeah, he survived too, don't you know! I *think* they're labeled, but they're not in separate folder, just in the default folder when you click on the photos link.
This is the only way I can help at the moment, but I will try soon to move them to another place, maybe even here, and also scan the others I have.
Thanks for your patience.
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 23, 2004, 09:26:21 PM
Agrebear

  No one called you a liar ...some of your comments about having "secret information about the real fate of the Romanovs" --remember-- seemed to remind people of similar cryptic remarks other people--such as "Rodger" has sometimes posted!

  This is one problem with technology-- I can come to this site and tell people  that I'm an 87 year old asian hermit named Dyum Chi Quai--and you have no immediate way of proving that I am not...Unless you do an elaborate email check.

(Not an asian monk ;))
just
Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 09:27:50 PM
AGBear,

You're kidding, right?  :o This certainly is a very paranoid bunch  ::)  
I am not sure if I want to be the one to call Alec Knight at this point, frankly I am developing a bit of a headache from all this! But maybe someone else wants to step in and do it? Any volunteers? I think at the very least Alec did get my initial email, the most I am willing to accept here is that he forwarded it to Litwin and Litwin may have taken over from there or just told him what to say. But even that is sort of iffy, but I am not dismissing it one way or another.

Dashkova,
Please understand, I am not questioning what you are telling us, I am sure you are being sincere. Of course I don't expect you to come up with a dissertation on this guy! I am just saying that before I dismiss all this completely based solely on this Litwin character I want to hear more from the scientists who are involved in this research and I want to see the data from their new work, if it does in fact exist. I want to know exactly why they believe that these bones do not belong to the IF, I want reasons other than what they already gave in their current paper. Litwin or no, it seems to be a fact that this is what they believe.
I would also like to see the photos you have, so please let me know when you are able to upload them. And of course I am willing to listen to anything else you have to tell us, just as I am willing to listen to what the other side has to say. I am not trying to prove or disprove anything here, I just want to find out the facts... That's all  ::)

H
Quote
Helen and others,

When I first joined this discussion board,  I was told I was not me because a few thought I was Rodger.  Since I am not Rodger  I couldn't help but wonder how in the world they came up with this  idea.  So I posted that I was not Rodger. The responce amazed me.  I was told I was a lier....    Finally, the forum admin. had to step in and tell everyone I couldn't be Rodger.

  

Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 23, 2004, 09:37:27 PM
Rodger certainly did love attention, as I remember.
Too bad that he's not here to contribute.

Seriously-- If this is in fact "Rodger's" doing and if he is this paranoid-- then I do worry for his mental health...He may be a danger to himself and others if he really thinks that people are out to get him because he is a Romanov .

R.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 23, 2004, 09:45:30 PM
I never had the pleasure of interacting with "Rodger" or even seeing his postings first hand, so I can't comment on that one. In fact, I still don't even understand how they know that he and Litwin are one and the same. The only answers I got about that so far is "trust me I got this info from a reliable secret source" type of stuff. This answer is no better than the one from Alec Knight(or Rodger, or Litwin, or from whomever supposedly responded to my email) that said "trust me, I have some information that proves this but I can't tell you about it".  So if no one is really talking, I have the right to believe whatever makes sense to me and question them all...

H

Quote
Rodger certainly did love attention, as I remember.
Too bad that he's not here to contribute.

Seriously-- If this is in fact "Rodger's" doing and if he is this paranoid-- then I do worry for his mental health...He may be a danger to himself and others if he really thinks that people are out to get him because he is a Romanov .

R.

Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 24, 2004, 12:53:36 AM
Quote
If Litwin was only a contributor in the form of supplying them with historical info or something like that, then he would have been mentioned in the acknowledgements or the citations (if he ever published anything) but not as a co-author. Helen


Helen,

There is always the possibility that Litwin may have provided contributions in the form of historic background to the Stanford paper, rather than be directly involved with any benchwork:

1. In the Introduction the paragraphs which refer to exerpts from the books of Summers and Mangold, Massie and Mc Neal, may easily be the type of inclusions provided by a non scientist. There are a numerous examples dispersed throughout the Introduction which collectively do there best to discredit the Romanov remains.

2. The Chain of custody paragraphs in Materials and Methods may have been provided by the same source.

If this were the case, then co-authorship would be the expected reward.

It would be interesting to learn if any connection exists between Litwin and the Russian Expert Commission Abroad?

It is extraordinary that a Stanford scientific paper has become involved in using a number of references which are at best questionable with regard to their veracity.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 24, 2004, 06:15:44 AM
Belochka wrote:
There is always the possibility that Litwin may have provided contributions in the form of historic background to the Stanford paper, rather than be directly involved with any benchwork:

1. In the Introduction the paragraphs which refer to exerpts from the books of Summers and Mangold, Massie and Mc Neal, may easily be the type of inclusions provided by a non scientist.


***Yes.  He had a lot of help with this, too. I don't know a lot about scientific journals, but perhaps persons providing historical background for a topic would be included, though it seems just as straightforward to cite authors in the bibliography.  Certainly that should have been preferred from a professional standpoint to having a claimant (with an agenda) listed as an author.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 24, 2004, 07:19:05 AM
Yes, that was exactly my point too. To me it seems highly unusual that they would make a person a co-author, who only furnished them with some dubious historical information that seems to have come from a third or fourth source anyway... as opposed to this person having made some real scientific contribution (since this is a scientific paper after all). Normally, like you said, Dashkova, I believe they would have just cited the historical sources in their references. But this paper seems to be so unusual to begin with, the way some of the things are presented as undeniable proof (like the "proof" for the identity of the finger or of Elizabeth's remains) was pretty unusual for a scientific paper. Perhaps part of the deal with Litwin was for him to be acknowleged in this paper in a major way, and since they couldn't cite him because he never published anything, this is why they had to make him a co-author? Oh, who knows....

Helen

Quote
I don't know a lot about scientific journals, but perhaps persons providing historical background for a topic would be included, though it seems just as straightforward to cite authors in the bibliography.  Certainly that should have been preferred from a professional standpoint to having a claimant (with an agenda) listed as an author.


Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 24, 2004, 07:34:46 AM
Who is this "Russian Expert Commission Abroad'? Are they also connected with the Russian Orthodox church? From what I understand, Zhivotovsky works for the church so that seems to be the angle of his agenda in this case, but who are these people who in fact paid for the Stanford research? And why is the orthodox church so set on disproving that the bones interred at St P&P belong to the IF?  I wouldn't be at all surprised if there was a connection among all of them, but what is their point??  
Yes, Belochka, it is quite extraordinary that Stanford is involved at all in this, and this is the only thing in my eyes, that may give it any kind of credibility right now, as in "let me see what they have to say in their new study"- type of thing, if the new study even exists. The Stanford connection is why I started taking a closer look at all this in the first place! I didn't even realize when I made this posting that there was so much peripheral drama involved!!  :-/

Helen

Quote

It would be interesting to learn if any connection exists between Litwin and the Russian Expert Commission Abroad?

It is extraordinary that a Stanford scientific paper has become involved in using a number of references which are at best questionable with regard to their veracity.

Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 24, 2004, 09:06:51 AM
First,
As to our being "a paranoid bunch"...This forum is only about seven months old. In the first three months, we were subject to at least FOUR imposters including Rodger, who pressed ridiculous claims and theories and who would come back as "different" users with different names, but were really the same person. It took me a long time to ferret out the truth...Paranoid? no...sceptical with good reason is really more like it.

As for Rodger, HE started posting only as a "guest" claiming that he had to "protect his real identity" and could not "reveal personal information"...he claimed to be a genetic forensic biologist and an expert...and that he knew alot of "secret information".
Here is the last private message I got from him, after merely asking "if he knew Daryl Litwin." Please note the time of the message:
Jun 8th, 2004, 9:59pm
Well, I do know him.  He's an intensely private person who maintains a low profile.  He told me about some group that is bent on wrecking the Knight Group's efforts to set the record straight.  I had wondered if the problems Bob had been having might be related to this.

Between 10pm and 3am that night, literally every posting from Rodger DISAPPEARED (and not by me) which concerned the IF remains (there are some fifty or so remaining which have nothing to do with anything search member name  _Rodger_ .  Now in the law there is a concept of "Res Ipsa Loquiter" the thing speaks for itself...I think Rodger removing all of the postings tells you everything you need to know about a Rodger/Litwin connection.
It was Dashkova who told me first about Rodger, and she sent me plenty of "hard evidence" to prove what she said.
FA
Title: Re: New study questions identity of Romanov bones
Post by: Annie on September 24, 2004, 09:44:17 AM
Quote
Just to comment about this Litwin fellow--he's been around on some of the boards I've been on and has spouted his crazy theories to me.

This is getting beyond ludicrous to me.


Oh so he HAS been doing this other places  ::) thanks for telling us that, Lanie.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 24, 2004, 09:44:29 AM
Thanks for sharing that with us, FA. Dashkova sent me some additional information privately about this whole Rodger thing, so it makes more sense to me now than it did when all anyone would say is that there is 'proof' from some 'secret' source. You can't blame people for being skeptical when they are told something like that, can you?
Four imposters in three months? Boy, if this is really true than this person needs to get a life... and a good psychiatrist  ;)

H
Quote
First,
As to our being "a paranoid bunch"...This forum is only about seven months old. In the first three months, we were subject to at least FOUR imposters including Rodger, who pressed ridiculous claims and theories and who would come back as "different" users with different names, but were really the same person. It took me a long time to ferret out the truth...Paranoid? no...sceptical with good reason is really more like it.

As for Rodger, HE started posting only as a "guest" claiming that he had to "protect his real identity" and could not "reveal personal information"...he claimed to be a genetic forensic biologist and an expert...and that he knew alot of "secret information".
Here is the last private message I got from him, after merely asking "if he knew Daryl Litwin." Please note the time of the message:
Jun 8th, 2004, 9:59pm
Well, I do know him.  He's an intensely private person who maintains a low profile.  He told me about some group that is bent on wrecking the Knight Group's efforts to set the record straight.  I had wondered if the problems Bob had been having might be related to this.

Between 10pm and 3am that night, literally every posting from Rodger DISAPPEARED (and not by me) which concerned the IF remains (there are some fifty or so remaining which have nothing to do with anything search member name  _Rodger_ .  Now in the law there is a concept of "Res Ipsa Loquiter" the thing speaks for itself...I think Rodger removing all of the postings tells you everything you need to know about a Rodger/Litwin connection.
It was Dashkova who told me first about Rodger, and she sent me plenty of "hard evidence" to prove what she said.
FA

Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 24, 2004, 01:14:31 PM
     Agrbear did make a very good point earlier...a few calls or emails to Stanford ought to resolve a lot of this.

     Up until recently I did not realize just how many people "Rodger" has known and affected (assuming that our Rodger and Mr. Litwitt are the same person) and while no doubt he is free to visit this -- or any other web site --  the possibility that "Rodger" may actually believe that he is being threatened by unknown forces or targeted because he thinks that he has Romanov DNA is very troubling. (actually I used to think that he was just a neoconservative-reactionary type with Divine Right of Kings tatooed on his arm  ;D lol) Seriously... I do hope that he is ok.

   Alas I do not have access to any "secret" information /I am not related to any lost Romanovs/and I don't have any cryptic archane evidence passed down from generation to generation. Maybe this whole thing is a Giant Macguffin -- or maybe it is an actual investigation regarding the remains.

I'm just going to wait and see.  

R.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 24, 2004, 01:21:20 PM
rskkiya,

Thank you. It's nice to see someone else trying to be a little more open-minded and objective about examining this case.

Helen

Quote
   
  Maybe this whole thing is a Giant Macguffin -- or maybe it is an actual investigation regarding the remains.

I'm just going to wait and see.  

R.

Title: Re: New study questions identity of Romanov bones
Post by: Janet_W. on September 24, 2004, 02:44:54 PM
A giant MacGuffin indeed, rskkyia!

Alfred Hitchcock, wherever you are, I hope you're enjoying this!  ;)
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 24, 2004, 02:46:32 PM
Ok,
first, there is a very strong possiblilty that Dr Knight is indeed at ASU for a conference or something. That in and of itself is not conclusive. What IS disturbing, to me anyway, is that those people who actually know Dr. Knight personally all agree that these responses, both to Helen and JonC are NOT consistent with Alec Knight.

We do not know Dr. Knight ourselves, so we have asked a most trusted colleague who does to contact him and let us finally unravel what is going on here. Results expected Monday or so.
FA
Title: Re: New study questions identity of Romanov bones
Post by: Valmont on September 24, 2004, 06:52:03 PM
Besides, The first thing I read about AGRBear was "Rodger sent me here"... and Vera_Figner  sent her  information about Litwin, and her answer was "I am aware of Rodger's claims" now with all this "Fairy tale" story about having secret information-James-Bond-Style story, how can she expect  to be taken seriously??.. She made people think she was Rodger, even I thought of that untill the FA told me she was not..
A lot of people, including me has given her the oportunity to be taken seriously if she just answers a few questions, and then again, she  changes the subject....
Title: Re: New study questions identity of Romanov bones
Post by: Valmont on September 24, 2004, 07:07:25 PM
Quote
Helen,
The information about Rodger was sent to us by several sources, both wholly reliable.  Not wanting to reveal them, I simply asked Rodger in a private email if he knew a fellow Phoenix resident named Daryl Litwin. That was the day he disappeared from the forum.
FA


But, isn't he still posting as "Douglas"?....
Title: tRe: New study questions identity of Romanov bones
Post by: Robert_Hall on September 24, 2004, 07:39:09 PM
I freely admit to being  pretty closed minded about this whole story.  I personally look at any new Romanov "mystery" as diversionary amusement. Attempt at deception with the potential for fraud.
Naturally, I have no proof for or against any of the players in this scenario. To me, it is simply a closed case.
Now, the dectective story going on I am enjoying. I like the talents displayed in uncovering the different angles. You are all far more talented than I am in this sort of searching, digging, discovery.
I happen to feel, quite truthfully, that you will come up with the same conclusion I have, only through a much fairer process.
Now, as for Rodger/Litwin. I know only the former poster here. I found him obnoxious and exactly as has been said- reactionary "Divine Right" blabbering.  I do not suffer people like that very well.  He sort of "fell off" soon after my experiencing him & so, I did not have to "suffer" him long.
Hey, I honestly cheer you on! And, I will continue to follow, probably put in my biased comments now and then.
Like I said, an entertaining diversion !!
Cheers,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 24, 2004, 07:51:49 PM
Valmont,

I am so confused...Are you  suggesting  that either ''Vera_Figer" or "Agrbear" could even possibly be connected with "Rodger" and his shenanigans when visiting this site?

I know "Vera_F" and hold her in the highest esteem!

Agrbear must defend herself...

Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 25, 2004, 07:36:41 AM
Guys,

Can we try to stick to the topic please? The topic is not about "Rodger" or who is pretending to be "Rodger", or who spoke to "Rodger". The topic is about what to make of this Stanford research paper... :D

H
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 25, 2004, 08:05:47 AM
Helen
Good point. With hope we should stand in a clearer light on monday, after people have heard from Stanford and Dr. Knight is i.d'ed.
Until then- we are all just milling about.  ;)

R.
Title: Re: New study questions identity of Romanov bones
Post by: Annie on September 25, 2004, 09:33:32 AM
I really don't see how we can separate the two, because 'what to make of the research paper' totally involves this guy. But I will not comment anymore until FA  posts his results on Monday.
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on September 25, 2004, 09:33:55 AM
Well, Helen, that is exactly what is happening, is it not? Litwin/Rodger is connected to this Stanford story. Or so it seems at the moment.
As for Douglas being Rodger, I do not think so. I e-chat with him personally, off AP & he does not come accross at all like the aforementioned semi-fascist.
Best,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 25, 2004, 10:50:16 AM
Hi Annie,

Yes and no. I understand that when the Stanford Pandora's box opened up and "Rodger" (who is probably Litwin) popped out, people wanted to get to the bottom of this, and I do too, believe me. And if Rodger is involved in all this, it is quite disturbing and definitely very damaging to the credibility of the Stanford research. When I initially made this posting, I had no idea whatsoever that there was a "Rodger" involved or anything even close to it. I read the Stanford paper and saw some valid points that Knight et al made, and also some invalid points. I wrote to the author and pointed out all the inconsistencies and asked him for explanations. Unfortunately, the author chose not to answer any of my questions, although he acknowledged that they were valid. He said that they now have absolute proof and that it will soon be published. This pending release of "proof" may or may not pan out, we shall see in the future. But after I received his reply, I felt compelled to go on the forum and share this information to see if anyone knows anything more about it and what people's opinion would be. And this is when we all found out about the "claimant" who is involved in this research. To be honest, I feel that the person who responded to me was actually Alec Knight or at least the response was sent with his full knowledge and approval. But Rodger or no Rodger,  Litwin or no Litwin, I would still like to find out more about the actual Stanford team research and what they think they have and why Gill's results are inconsistent. Even if Rodger is Litwin and Litwin is involved in this research and is behind Knight's replies, I still have the same questions for them except because of Litwin's co-authorship, they lost more points and credibility in my eyes... But fact still is, Stanford research did point out some serious problems with the initial testing, which doesn't necessarily mean that these are not the bones, but I wanted an explanation one way or another, and that's why I am willing to listen to what else they have to say, except that they won't talk. Suppose on Monday we find out that Knight is the one who responded? How does that change things? But if we find out that Rodger is Litwin and Litwin is behind all this, then I still have the same questions about all this plus a BIG question about their agenda... So yes, it may be partially about Rodger/Litwin/claimant to the Russian throne being involved, but it's mostly about the science...  :)

Helen

Quote
I really don't see how we can separate the two, because 'what to make of the research paper' totally involves this guy. But I will not comment anymore until FA  posts his results on Monday.

Title: Re: New study questions identity of Romanov bones
Post by: Annie on September 25, 2004, 11:02:23 AM
I believe you that you had no idea when you posted this, and I agree we need answers no matter what. But I do feel that if "Rodger" is involved, the entire project is tainted and questionable, so he is part of it and therefore it is not off topic. But I do think the discussion of Rodger has run its course until we have more information. Perhaps the real Litwin will post!
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 25, 2004, 11:04:41 AM
Helen,
Just wondering, since yours is a scientific background, how common is it that a scientist would proclaim "absolute *proof*" about any research.

I am not a scientist, but I live with one and know several others, who think it's odd that one of that profession would make such a statement.
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 25, 2004, 11:07:44 AM
Helen,
This actually IS about Rodger, who IS Litwin. Our problem with these developments is this. Knight's report is NOT about proving that any specific person IS a claimant. period. the Knight report is that Gill's work is probably flawed, which is reasonable given the DNA technology of 1993, and that the relic of GD Ella doesn't match.
WHY is there suddenly this "claimant" proof which has nothing to do with the original report? Litwin is the one with a "claimant" agenda. For Knight to suddenly start to "take sides" destroys his scientific credibility by removing any objectivity in the results. THIS is a 180 degree turn around from what everyone who has been in contact with Dr. K reports was his position.
FA
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 25, 2004, 11:22:44 AM
Dashkova,
I think most people with a science background can tell you that you really can't claim anything with a 100% certainty. Yes, that is an odd statement coming  from a scientist, but we have to keep in mind that Alec Knight may have a different way of speaking to non-scientists than to colleagues, and I didn't write to him as a colleague, but more as a layperson inquiring about this case from an article I read. Maybe that had something to do with his wording... What do you think?

Quote
Helen,
Just wondering, since yours is a scientific background, how common is it that a scientist would proclaim "absolute *proof*" about any research.

I am not a scientist, but I live with one and know several others, who think it's odd that one of that profession would make such a statement.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 25, 2004, 11:29:03 AM
Actually after I just wrote my last reply and before I saw this one of yours, FA. I re-read mine, thought about it and changed it a little. Yes, the claimant agenda does change a lot here but I also want to see Knight's proof as to why he now believes this claimant? Don't you think it would be interesting to find out? Unless,  Knight knows nothing about this response sent to me, which I find extremely hard to believe. I didn't know that Knight was not supporting Litwin's claim before, I thought he did all along. In which case, why did he allow Litwin to be part of this study initially??
Quote
Helen,
This actually IS about Rodger, who IS Litwin. Our problem with these developments is this. Knight's report is NOT about proving that any specific person IS a claimant. period. the Knight report is that Gill's work is probably flawed, which is reasonable given the DNA technology of 1993, and that the relic of GD Ella doesn't match.
WHY is there suddenly this "claimant" proof which has nothing to do with the original report? Litwin is the one with a "claimant" agenda. For Knight to suddenly start to "take sides" destroys his scientific credibility by removing any objectivity in the results. THIS is a 180 degree turn around from what everyone who has been in contact with Dr. K reports was his position.
FA

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 25, 2004, 11:38:27 AM
Sure, anything's possible, but I don't know...in my own field I tend to practice good habits of being clear about what I say, and said in a way (to whomever) that follows the rules of the discipline.

I mean, this works the same way in history nomenclature.  No matter who I was writing to, I would never say there was absolute proof about anything that had ever been remotely considered controversial.  That's irresponsible and unprofessional in my view, and I would guess this goes for anyone in any field.  Even mathematics!
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 25, 2004, 11:39:49 AM
FA,

In his reply, Knight never actually mentioned to me that his proof is based on a claimant, he just said that he now believes without any doubt (or something to that effect) that these bones don't belong to the IF and that the new data that's supposed to be published soon will prove that. Well, you all saw the email... I only found out about the claimant's involvement here in the forum. But I think JonC told us that Knight did say something about this Litwin's claim? I can't remember now so I have to go check in the postings. But if he is not supporting Litwin's claim, why would he let this guy be involved in his study and even let his name be added to the authorship credit? I take that as supporting him, in some ways at least, don't you think? Well, lets wait until Monday and see what happens....

Quote
WHY is there suddenly this "claimant" proof which has nothing to do with the original report? Litwin is the one with a "claimant" agenda. For Knight to suddenly start to "take sides" destroys his scientific credibility by removing any objectivity in the results. THIS is a 180 degree turn around from what everyone who has been in contact with Dr. K reports was his position.
FA

Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 25, 2004, 11:45:51 AM
From what I understand, Litwin brought the idea to Knight, and contributed the historical background to the report. Knight knew nothing about Litwin's claim at the time, from what I can tell.
The fact that he now "supports" a claimant (who may or may not be Litwin) is exactly what is new and different. IF indeed it IS Litwin, he has destroyed the credibility of the report.
I wholly agree that if Knight was the author of all of these reports, we all want to see this new evidence, which frankly, runs contrary to what is already known.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 25, 2004, 11:47:00 AM

Quote
Sure, anything's possible, but I don't know...in my own field I tend to practice good habits of being clear about what I say, and said in a way (to whomever) that follows the rules of the discipline.

I mean, this works the same way in history nomenclature.  No matter who I was writing to, I would never say there was absolute proof about anything that had ever been remotely considered controversial.  That's irresponsible and unprofessional in my view, and I would guess this goes for anyone in any field.  Even mathematics!

In one of my previous responses I think I did mention that i thought his reply sounded unprofessional, so this was part of what I meant. But at the time I just thought it was because it was a response to someone who is writing to him from a yahoo email address with a more of a "Romanov" question than a scientific question, so I didn't dwell on it too much. In any case, hopefully we will have our answer and put this part of speculation to rest one way or another....  :P

Helen

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 25, 2004, 11:52:25 AM
Quote
FA,

In his reply, Knight never actually mentioned to me that his proof is based on a claimant, he just said that he now believes without any doubt (or something to that effect) that these bones don't belong to the IF and that the new data that's supposed to be published soon will prove that. Well, you all saw the email... I only found out about the claimant's involvement here in the forum. But I think JonC told us that Knight did say something about this Litwin's claim? I can't remember now so I have to go check in the postings. But if he is not supporting Litwin's claim, why would he let this guy be involved in his study and even let his name be added to the authorship credit? I take that as supporting him, in some ways at least, don't you think? Well, lets wait until Monday and see what happens....



That's exactly right, Helen.  I really wish JonC would respond to the questions we've asked over the last couple of days, it would help to clarify things.  And yes, one of his posts stated that Knight had been pretty insistent that he believed the claimant, meaning Litwin.

I do know that a couple of years ago Knight was shown Litwin's "evidence" and was apparently impressed. So, it's not like the claimant has just popped out of the woodwork late in the research or after the article was published.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 25, 2004, 11:56:48 AM
"From what I understand, Litwin brought the idea to Knight, and contributed the historical background to the report. Knight knew nothing about Litwin's claim at the time, from what I can tell.The fact that he now "supports" a claimant (who may or may not be Litwin) is exactly what is new and different. IF indeed it IS Litwin, he has destroyed the credibility of the report. "
Oh, I see... Now I understand what you are talking about. I thought that everyone who knew about this was saying that Knight had accepted Litwin as the claimant all along and this is why he took him for this study!

"I wholly agree that if Knight was the author of all of these reports, we all want to see this new evidence, which frankly, runs contrary to what is already known"
This is exactly what I have been trying to say about this all along. We are finally on the same page here  ;)


Quote
From what I understand, Litwin brought the idea to Knight, and contributed the historical background to the report. Knight knew nothing about Litwin's claim at the time, from what I can tell.
The fact that he now "supports" a claimant (who may or may not be Litwin) is exactly what is new and different. IF indeed it IS Litwin, he has destroyed the credibility of the report.
I wholly agree that if Knight was the author of all of these reports, we all want to see this new evidence, which frankly, runs contrary to what is already known.

Title: Re: New study questions identity of Romanov bones
Post by: AGRBear on September 25, 2004, 05:28:17 PM
I apologize Helen for having to reply to ryskkiya and the others, because this interrupts this thread.

For the 100th time,  let me state:  (1) I am not Rodger; (2) I am not Shay McNeal [this is the other rumor running around]; (3) I am not part of any kind of conspiracy hoping to convince you that there are any people alive who are children of Nicholas II, Alexandra, Olga, Tatiana, Marie, Anastasia or Alexie or any other Romanov; (4) I am anti-communists which stirs the blood of those who are pro-communism; (5) I am pro-democracy, I live quite happily in the USA, and, I will vote for Bush; (6)  I do not believe everything I read about Nicholas II, Rasputin , etc. etc. etc.  in newspapers, magazines, books,  or,  postings on this discussion board; (7) and,  last, but not least,  yes,  I was about five years old when I was told a story about the events which occured the last night in the Ipatiev House, and,  my search is to prove the story to be  either  true or untrue, and,  if this story is  untrue then I want to discover why I was  told  a "white rumor" or a  "red herring" so long after the event occured.     And, NO,  I don't intend to share the story at this time.

If you believe me or if you do not,  please,  just react to my postings on the subjects being discussed at the time. [I believe I was the one who suggested contacting Stanford.]  This would be fair to the rest of the people who really don't care who I am or whom you think I might be.

Please, please,  pleease,   this posting doesn't need any responce.  Let's just continue the subject which Helen has presented us.  If you find the urge, anyway,  just write to me personally.

Truly yours,

AGRBear

PS  Ryskkiya -  My personal message to you has been blocked and is not deliverable to your mail box.  She wrote:
Quote
Valmont,

I am so confused...Are you  suggesting  that either ''Vera_Figer" or "Agrbear" could even possibly be connected with "Rodger" and his shenanigans when visiting this site?

I know "Vera_F" and hold her in the highest esteem!

Agrbear must defend herself...

Rskkiya


-----

Valmont:  I did not attempt to make anyone believe I was Rodger, who had asked me to go to a different thread where a similar discussion was taking place.  I'd have to go back into the posts to give you what the thread was.  But that's not important.  What is important is:  You were jumping to the wrong conclusions.

Quote
Besides, The first thing I read about AGRBear was "Rodger sent me here"... and Vera_Figner  sent her  information about Litwin, and her answer was "I am aware of Rodger's claims" now with all this "Fairy tale" story about having secret information-James-Bond-Style story, how can she expect  to be taken seriously??.. She made people think she was Rodger, even I thought of that untill the FA told me she was not..
A lot of people, including me has given her the oportunity to be taken seriously if she just answers a few questions, and then again, she  changes the subject....

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 25, 2004, 05:39:41 PM
Quote
I apologize Helen for having to reply to ryskkiya and the others, because this interrupts this thread.... I am pro-democracy, I live quite happily in the USA, and, I will vote for Bush....
Truly yours,

AGRBear




AGRBear,

It's ok... your posting actually gave me a much needed chuckle! Only one thing... please don't vote for Bush  ;) ;D

Helen
Title: Re: New study questions identity of Romanov bones
Post by: AGRBear on September 25, 2004, 06:13:46 PM
OOOOOOOOoooooooooooooh  dear,  I did mentioned I was voting for Bush.

Attention ALL:
Helen has written her plea and let that stand for all who think I should not....   ;D

AGRBear

Back to Helen's thread:

Quote
"From what I understand, Litwin brought the idea to Knight, and contributed the historical background to the report. Knight knew nothing about Litwin's claim at the time, from what I can tell.The fact that he now "supports" a claimant (who may or may not be Litwin) is exactly what is new and different. IF indeed it IS Litwin, he has destroyed the credibility of the report. "
 Oh, I see... Now I understand what you are talking about. I thought that everyone who knew about this was saying that Knight had accepted Litwin as the claimant all along and this is why he took him for this study!

"I wholly agree that if Knight was the author of all of these reports, we all want to see this new evidence, which frankly, runs contrary to what is already known"
This is exactly what I have been trying to say about this all along. We are finally on the same page here  ;)



Title: Re: New study questions identity of Romanov bones
Post by: JM on September 25, 2004, 06:19:27 PM
You're voting for Bush and you're pro-democracy? I'm just confused. ???

Think about the environment. :(
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 25, 2004, 06:36:59 PM
As MUCH as I really want to say something here,  ;D
I can't. :-X
Other than, please leave domestic politics to the zillions of other discussion boards out there.
Thanks,
FA
Title: Re: New study questions identity of Romanov bones
Post by: Olga on September 25, 2004, 09:06:30 PM
Quote
I am pro-democracy, I live quite happily in the USA, and, I will vote for Bush


This is just too funny.

Quote
 last, but not least,  yes,  I was about five years old when I was told a story about the events which occured the last night in the Ipatiev House, and,  my search is to prove the story to be  either  true or untrue, and,  if this story is  untrue then I want to discover why I was  told  a "white rumor" or a  "red herring" so long after the event occured.     And, NO,  I don't intend to share the story at this time.



Just this passage makes you sound like you have an agenda. If you know something then just spit it out.

Krasnaya Olga


Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 25, 2004, 09:19:37 PM
Olga
While I agree with you whole heartedly about this issue...I think we ought to try to stay focused on the topic of the stanford research.  8)

Red Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: JonC on September 26, 2004, 09:42:01 AM
I think the FA has a good handle on the situation with regards to Dr. Knight's work. Dr. Knight's research does cloud Dr. Gill's research and that IS the main concern.

Who knows, maybe Dr. Knight does have ulterior motives with a possible 'claimant' inspiring him to review Dr. Gill's conclusions and successfully rebuffing them. This doesn't make his findings any less credible.

My concern is that he doesn't try to pull the 'wool' over our eyes to slant his findings to fit his so-called- claimant..if he does have one.

I remember clearly in my conversation with him ( he did identify himself as Dr. Knight) when I called him at Stanford U that he sincerely believed his claimant's photos were 'the best he had ever seen'.

side note.

Someone..I forget who..asked me if I was a priest because I believe in the'Holy Mother Russia' concept.

NO, I'm not a priest or connected to the Russian Orthodox church in any way although I do visit the Nyack, NY church at times to stay in touch with my Russian roots.

I am a christian and believe that Jesus is my Lord and Savior.

I do believe that there will be upheavals..wars etc., around and in Russia simply because Russia hasn't, in my oppinion, been made whole again through the re-establishment of the Tsar's guidance.
Best Regards. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 26, 2004, 10:50:07 AM
Thank you for your response, JonC.  It's interesting to know that he was at Stanford when you spoke to him!

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 26, 2004, 12:19:01 PM
Quote
Dr. Knight's research does cloud Dr. Gill's research and that IS the main concern.


This was my original point exactly so we now made a full circle!

'"My concern is that he doesn't try to pull the 'wool' over our eyes to slant his findings to fit his so-called- claimant..if he does have one.""

Don't worry JonC, he won't be able to do that, we are all watching him now  :o  ;D
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 26, 2004, 03:18:30 PM
Dr Gill? Dr. Knight ? "Pulling the wool over our eyes?" :o

  Well, at this point I am just going to wait until we have heard something from Stanford or until we can actually see some reports or results... This whole thing may end up being a tempest in a teapot, although if 'rodger' is the oftnamed claimant it certainly will be a very odd situation.

hoping for information soon -(conspiracies always give me a headache!)- I remain
yours truly
Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 26, 2004, 10:04:51 PM
If Litwin is proven to be a claimant who has a hidden agenda, and his association with the Russian Expert Commission Abroad can be shown to have a direct association, one can only question the impartiality of the Stanford team to conduct the assays in the first place.

Perhaps some of the following questions need to be directed to Knight:

1. Who initiated the inquiry?

2. Who provided the funding to conduct these experiments?

3. Who provided the authorization for the experimentation to go ahead?

4. The inclusion of mass media references which themselves are suspect with regard to the claims they allege.  
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 27, 2004, 08:12:40 AM
Quote
If Litwin is proven to be a claimant who has a hidden agenda, and his association with the Russian Expert Commission Abroad can be shown to have a direct association, one can only question the impartiality of the Stanford team to conduct the assays in the first place.

Perhaps some of the following questions need to be directed to Knight:

1. Who initiated the inquiry?
 
2. Who provided the funding to conduct these experiments?

3. Who provided the authorization for the experimentation to go ahead?

4. The inclusion of mass media references which themselves are suspect with regard to the claims they allege.  


I second all that...  :) For question number 2, I believe it was the Russian Expert Commission Abroad who funded the study.
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 27, 2004, 01:56:28 PM
Hi everyone!
So, here is the answer about Dr. Knight. He is indeed in Tempe Arizona right now, at ASU. Stanford is indeed still his "employer". The emails and calls are indeed from him. He is about to publish a new paper "very soon". This new paper will answer all of the questions we have, and if there are other questions, he will be happy to answer them after the paper has been published.
In the mean time, he won't say anything more until after the paper has been published, including the identity of the people working with him.
SO, guess we all just have to wait until the paper comes out, as it would just be speculation until then.

FA
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 27, 2004, 02:17:49 PM
Thanks for following up on that, FA! All this is what I strongly suspected already  :D So he wouldn't even tell approximately when his paper is coming out? I guess we're back to square one, everybody (see my initial posting  ;D)

H

Quote
Hi everyone!
So, here is the answer about Dr. Knight. He is indeed in Tempe Arizona right now, at ASU. Stanford is indeed still his "employer". The emails and calls are indeed from him. He is about to publish a new paper "very soon". This new paper will answer all of the questions we have, and if there are other questions, he will be happy to answer them after the paper has been published.
In the mean time, he won't say anything more until after the paper has been published, including the identity of the people working with him.
SO, guess we all just have to wait until the paper comes out, as it would just be speculation until then.

FA

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 27, 2004, 03:54:41 PM
FA:  Thanks very much for the update!

Helen:  I can understand your viewpoint, but will have to speak for myself and say that for *me*, it's definitely not back to square one.
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on September 27, 2004, 06:23:32 PM
I will just be happy when this paper is published so we can find out what this is all about.I'm very interested in the findings and what this "claiment" has to do with it,if he has anything to do with it.It's going to be very interesting for our discussion here but man it's going to be hard waiting. :P
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 27, 2004, 07:05:34 PM
Quote
Helen:  I can understand your viewpoint, but will have to speak for myself and say that for *me*, it's definitely not back to square one.



Dashkova,

Ok maybe not to square one, after all Litwin is still the co-author of this paper and still an imperial claimant as far as we know... but basically we are back to the question how did these Stanford scientists get involved in all this? Do they know something that will prove this right...Or have they all lost their minds? I can't even begin to imagine what this proof could possibly be! I personally can't wait until this paper comes out, which could be next month or next year. "Very soon" is unfortunately a very loose term in the scientific world...

Helen

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 27, 2004, 07:09:23 PM
Quote
I will just be happy when this paper is published so we can find out what this is all about.I'm very interested in the findings and what this "claiment" has to do with it,if he has anything to do with it.It's going to be very interesting for our discussion here but man it's going to be hard waiting. :P

Merrique, you speak for all of us, I think (except maybe for Robert Hall ;) ) Well, hopefully everyone will keep an eye out for any new papers published by the Stanford Anthropology Department  :o  :D
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 27, 2004, 08:27:50 PM
I still can't help but wonder about a couple of things...

How about this one:
Most of us here have traveled out of town, state, country to attend conferences, handle business, tour, etc.  And not always, but usually, at least on a couple of occasions, there is the opportunity to go online, either at the host institute/university, hotel, even internet cafes.
Checking email is one of the first (and sometimes only) online activities one pursues when travelling.
Email is typically answered in the same fashion, through one's usual accounts.
But through an account at a university where one is simply attending/participating in a conference?
That's got to be very rare, simply because convenience and habit favor the usual accounts.

Personally, I think one brainwashed scientist is covering for one chronically lamebrained claimant.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 27, 2004, 08:32:19 PM
Quote


Dashkova,

Ok maybe not to square one, after all Litwin is still the co-author of this paper and still an imperial claimant as far as we know... but basically we are back to the question how did these Stanford scientists get involved in all this? Do they know something that will prove this right...Or have they all lost their minds? I can't even begin to imagine what this proof could possibly be! I personally can't wait until this paper comes out, which could be next month or next year. "Very soon" is unfortunately a very loose term in the scientific world...

Helen



Helen, I do agree with you, and can only add that I can speak only from my own perspective and it helps if you know any of the players of this -- as far as I am concerned -- scientific *game*.
I feel sorry for Alec Knight.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 27, 2004, 09:30:24 PM
Does anyone else here know (and yes, it's true) that Alec Knight et al shopped their original article to Nature Genetics and were turned down flat?

Their rejection was apparently accompanied by notes from three reviewers, Litwin and company believed one of those reviewers to be Gill, as it was his research that was being questioned.

Tonight, while plowing through some old emails, I came across the following gem, which was Litwin's response to Knight, in a discussion about the three reviews.  Parts of the review are snipped, with Litwin's commentary(he forwarded a copy to me, my address is listed first):

-Apparently-To: fantushinka@yahoo.com via web12803.mail.yahoo.com; 31 May 2002 12:21:06 -0700 (PDT)
Return-Path: <litwinde@yahoo.com>
Received: from web14202.mail.yahoo.com (216.136.172.144) by mta619.mail.yahoo.com with SMTP; 31 May 2002 12:21:05 -0700 (PDT)
Message-ID: <20020531192034.83723.qmail@web14202.mail.yahoo.com>
Received: from [65.58.139.192] by web14202.mail.yahoo.com via HTTP; Fri, 31 May 2002 12:20:34 PDT
Date: Fri, 31 May 2002 12:20:34 -0700 (PDT)
From:  "D. Litiwn" <litwinde@yahoo.com>  Add to Address Book
Subject: Re: FW: Knight
To: Fantushinka@yahoo.com
In-Reply-To: <B9192BBF.1F9B%aknight@stanford.edu>
MIME-Version: 1.0
Content-Type: multipart/alternative; boundary="0-1919543804-1022872834=:82381"
Content-Length: 2661

   
Hi Alec,

Although I know I can't offer much in the way of substantive scientific comments on this,  maybe I can at least offer my impressions on this review.  As far as review 3 is concerned, it seemed to me to be pretty much what you had expected.

Reviewer: 1

>This is a fascinating paper which deals with historically important genetic
discovery of the Romanov remains. Knight and colleagues quite sensibly point
out that there must be doubt about the site of the graves and that the
amplification of large PCR fragments is a little surprising.

Here, Reviewer 1 brushes off the criticism by not addressing the substance of the critique.  Instead, the reviewer seems to be relying completely upon the blood test of the Duke as a defense.   Is it possible that the reviewer doesn't understand the criticism?  Or is the reviewer simply trying to dismiss any criticism a priori by relying on the alleged Philip result?

>They wished to determine if the remains were indeed real by sequencing the mitochondrial DNA from the Tsarina's sister, Grand Duchess Elizabeth. They obtained DNA from the finger of the Grand Duchess and have obtained DNA sequence of the
mitochondrial DNA D-loop. The DNA sequences are presented. We can conclude a
few certainties.
1. The DNA from the Grand Duchess Elizabeth shows 16111C and 16129A,
whereas the DNA from the Tsarina was 16111T and 16129G
2. These women were not sisters.

>Knight et al have proven their case or have they?


The reviewer simply once again is relying solely on the DGE result without referring to the improbability of the Ekaterinburg result.  


>There must be uncertainty about any remains which made us look again at the
family tree. As true Brits we noticed that our own HRH Prince Philip, The
Duke of Edinburgh is a maternal relative of the Tsarina and Grand Duchess
Elizabeth. He is very much alive. He is the Great nephew through the
maternal side of the family and thus will have the same mitochondrial
genotype. In the original Gill et al paper, they obtained a blood sample
from Prince Philip and this sample has the genotype 16111T and 16129G - the
same is the Tsarina. Prince Philip is not related to the sample obtained
from the grave in Jerusalem.

>We then delved into the life of the Grand Duchess Elizabeth via a number of
web sites. We are now definitely moving away from our area of expertise and
we found all the information we had available was badly sourced. However, it
seems that Grand Duchess Elizabeth was an admirable woman who in her later
years devoted herself to good works and for these she was canonised by the
Orthodox Church. However, it seems she meet a violent death by being thrown
down a mine with some of her companions. There are even stories that bombs
were thrown in after, before the bodies (or parts of bodies) could be
recovered.

>Thus this work has presented a number of conclusions, but perhaps not what
the authors had proposed. We entirely agree with them that the DNA from the
grave in Jerusalem is not related to the DNA extracted from the bones found
at Ekaterinburg. Thus there are two possibilities. That HRH Prince Philip is
an impostor! Much more likely, is that the remains that have been so
carefully tendered in the grave in Jerusalem are NOT those of Grand Duchess
Elizabeth. This will prove to be bad news to the Orthodox Church.

My own impression is that this is the writing of a person who seems not understand the ancient DNA problem and does not appear to be taking it very seriously.  He or she simply wants to say "Philip therefore QED" and that's that.  The reviewer's severely restricted logical universe however has a curious entailment because he or she has essentially staked Philip's identity to the veracity of the Ekaterinburg remains.  

On the other hand, it could be a slight of hand on the reviewer's part to de-emphasize the ancient DNA critique.  This of course would entail that the critique has found its mark.  Intuitively, I suspect that the ancient DNA critique is very important and perhaps the article can be a good source of information for people on the apparent distinction between fresh and ancient DNA.

Daryl

     




Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 27, 2004, 11:15:09 PM
Quote
The emails and calls are indeed from him. He is about to publish a new paper "very soon". This new paper will answer all of the questions we have, and if there are other questions, he will be happy to answer them after the paper has been published.
In the mean time, he won't say anything more until after the paper has been published, including the identity of the people working with him.
SO, guess we all just have to wait until the paper comes out, as it would just be speculation until then.

FA


Thanks FA for providing all this information. It is very important not to jump to any conclusions.

Not until the second paper is published, only then we may be presented with a clearer indication as to which direction Knight's scientific findings are headed.


Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 28, 2004, 04:15:18 AM
Quote

Thanks FA for providing all this information. It is very important not to jump to any conclusions.

Not until the second paper is published, only then we may be presented with a clearer indication as to which direction Knight's scientific findings are headed.




Oh, *certainly*.  Keep thinking happy thoughts ;)
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 28, 2004, 07:02:26 AM
Quote
Most of us here have traveled out of town, state, country to attend conferences, handle business, tour, etc.  And not always, but usually, at least on a couple of occasions, there is the opportunity to go online, either at the host institute/university, hotel, even internet cafes.
Checking email is one of the first (and sometimes only) online activities one pursues when travelling.
Email is typically answered in the same fashion, through one's usual accounts.
But through an account at a university where one is simply attending/participating in a conference?
That's got to be very rare, simply because convenience and habit favor the usual accounts.


Well, I think regardless all this, we now know for sure that the emails were written by Dr Knight, so all this is a moot point... Let's not dwell on it, shall we?  ;)
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 28, 2004, 07:40:29 AM
I wish I had time to "dwell"

And I remain less than 100 percent convinced.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 28, 2004, 07:41:30 AM
Quote
   
Hi Alec,

Although I know I can't offer much in the way of substantive scientific comments on this,  maybe I can at least offer my impressions on this review.  As far as review 3 is concerned, it seemed to me to be pretty much what you had expected.

 Reviewer: 1

>This is a fascinating paper which deals with historically important genetic
discovery of the Romanov remains. Knight and colleagues quite sensibly point
out that there must be doubt about the site of the graves and that the
amplification of large PCR fragments is a little surprising.

Here, Reviewer 1 brushes off the criticism by not addressing the substance of the critique.  Instead, the reviewer seems to be relying completely upon the blood test of the Duke as a defense.   Is it possible that the reviewer doesn't understand the criticism?  Or is the reviewer simply trying to dismiss any criticism a priori by relying on the alleged Philip result?

>They wished to determine if the remains were indeed real by sequencing the mitochondrial DNA from the Tsarina's sister, Grand Duchess Elizabeth. They obtained DNA from the finger of the Grand Duchess and have obtained DNA sequence of the
mitochondrial DNA D-loop. The DNA sequences are presented. We can conclude a
few certainties.
1. The DNA from the Grand Duchess Elizabeth shows 16111C and 16129A,
whereas the DNA from the Tsarina was 16111T and 16129G
2. These women were not sisters.

>Knight et al have proven their case or have they?


The reviewer simply once again is relying solely on the DGE result without referring to the improbability of the Ekaterinburg result.  


>There must be uncertainty about any remains which made us look again at the
family tree. As true Brits we noticed that our own HRH Prince Philip, The
Duke of Edinburgh is a maternal relative of the Tsarina and Grand Duchess
Elizabeth. He is very much alive. He is the Great nephew through the
maternal side of the family and thus will have the same mitochondrial
genotype. In the original Gill et al paper, they obtained a blood sample
from Prince Philip and this sample has the genotype 16111T and 16129G - the
same is the Tsarina. Prince Philip is not related to the sample obtained
from the grave in Jerusalem.

>We then delved into the life of the Grand Duchess Elizabeth via a number of
web sites. We are now definitely moving away from our area of expertise and
we found all the information we had available was badly sourced. However, it
seems that Grand Duchess Elizabeth was an admirable woman who in her later
years devoted herself to good works and for these she was canonised by the
Orthodox Church. However, it seems she meet a violent death by being thrown
down a mine with some of her companions. There are even stories that bombs
were thrown in after, before the bodies (or parts of bodies) could be
recovered.

>Thus this work has presented a number of conclusions, but perhaps not what
the authors had proposed. We entirely agree with them that the DNA from the
grave in Jerusalem is not related to the DNA extracted from the bones found
at Ekaterinburg. Thus there are two possibilities. That HRH Prince Philip is
an impostor! Much more likely, is that the remains that have been so
carefully tendered in the grave in Jerusalem are NOT those of Grand Duchess
Elizabeth. This will prove to be bad news to the Orthodox Church.

My own impression is that this is the writing of a person who seems not understand the ancient DNA problem and does not appear to be taking it very seriously.  He or she simply wants to say "Philip therefore QED" and that's that.  The reviewer's severely restricted logical universe however has a curious entailment because he or she has essentially staked Philip's identity to the veracity of the Ekaterinburg remains.  

On the other hand, it could be a slight of hand on the reviewer's part to de-emphasize the ancient DNA critique.  This of course would entail that the critique has found its mark.  Intuitively, I suspect that the ancient DNA critique is very important and perhaps the article can be a good source of information for people on the apparent distinction between fresh and ancient DNA.

Daryl

    


Thanks for posting this, Dashkova. It's interesting that many of the comments made by these reviewers almost exactly mirror my own in the letter I wrote to Knight as well as comments I posted later here on this APTM thread.  Obviously we're all on the right track here, but I am not really sure what track Litwin is on. It's also interesting that Litwin (who is reportedly a psychology major, right?) feels that he can challenge the scientific judgement of hard core molecular geneticists, and other professionals well established in this field, on this matter. Besides the fact that what he says makes very little sense. I had to chuckle a little at Litwin's indignancy that the reviewer "staked Philip's identity to the veracity of the Ekaterinburg remains" which was actually a perfectly appropriate thing to do: of course Philip's DNA is one of the most crucial pieces of evidence here! Meanwhile, Alec Knight completely ignored this piece of evidence in his study and "staked" his conclusions "to the veracity" of a finger from scientifically dubious origin! And why doesn't anyone mention the tests that were done on Nicholas's alleged remains that were compared to the DNA of GD Georgi, Nicholas's II's exumed brother? Not only did those two sets of DNA match, they even turned out to have the same heteroplasmy! Does this mean that Nicholas's remains are for real while everyone else's aren't? I don't know about that... This piece just adds to all the evidence in favor of the bones being real.

Oh, what more can you say :-/... Belochka is right, as tempting as this is, let us not jump to any conclusions and let us wait for this new paper of Knight's that will supposedly answer all these questions. So let's see what he has to say.

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 28, 2004, 07:56:23 AM
All very wonderfully stated, Helen. Thank you for your views on the email.

And yes, I think we've all got way better things to do than continue dissecting this whole mess.  Certainly it's not very pleasant dredging up things I hadn't thought much about for the past couple years.

On to the things that matter! :)
Title: Re: New study questions identity of Romanov bones
Post by: Candice on September 28, 2004, 03:52:56 PM
It will be very interesting to see the DNA results.  Is the 16129G in Region 1 or 2?

The only way they can be sure if Alexandra and Elizabeth are sisters is by comparing Princess Alice's DNA with theirs.  Yes, they will have to exhume her body.  I think Prince Philip is definitely not a fraud!  I do however think that Alexandra was not Alice's daughter.  Only time will tell.  In the meantime Elizabeth is missing or is it Alexandra that's missing?

This proves that most of the stories were spin. Just "disinformation" pg. 145 'The Romanovs The Final Chapter' by Robert K. Massie.  

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 28, 2004, 05:20:36 PM
Quote
 I do however think that Alexandra was not Alice's daughter.  


What?  ???
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on September 28, 2004, 05:35:42 PM
Oh no here we go again! :o ??? :o
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 28, 2004, 05:47:18 PM
Candice.....PLEASE >:(

Do stay on topic! If you can justify this extreamly silly claim-- then take it to the Claimants Thread.
To be honest, with your track record -- dear-- I really don't think that many people will take you very seriously...

rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 28, 2004, 05:50:36 PM
Quote
Candice.....PLEASE >:(

Do stay on topic! If you can justify this extreamly silly claim-- then take it to the Claimants Thread.
To be honest, with your track record -- dear-- I really don't think that many people will take you very seriously...

rskkiya


Yes... we have one claimant too many on this thread already!!   :-/ ::)
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on September 28, 2004, 06:15:22 PM
and let us not discount the VERY probable idea that the bodies of Elisabeth and Sister Varvara may have been switched so BOTH bodies in Jerusalem should be tested to be certain.
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on September 28, 2004, 07:01:41 PM
The email from Litwin explains why "Rodger" was so quick to dismiss the testing of the mtDNA of Princess Katherine of Yugoslavia. This testing was done at Brown University in the US before the sample was taken from Prince Philip. However, it was done privately and the results were known only to a handful of people. They were certainly unknown to Rodger/Litwin. He said - private testing is invalid! (as if this would change the results!).

The scientist at BU I contacted was willing to compare the two findings for me and confirmed an exact mtDNA match between Katherine and Philip - as one would expect of two matrilineal descendants of QV. He said without question that these results - and others of living people with the same credentials - confirm that a QV descendant and her 3 daughters were found in the Koptyaki grave.

No wonder Litwin/Rodger didn't want to believe this - these results are beyond what has been published - and call his team's work into question.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 28, 2004, 08:05:53 PM
Quote
No wonder Litwin/Rodger didn't want to believe this - these results are beyond what has been published - and call his team's work into question.


Lisa, thanks for this information about Princess Katherine's of Yugoslavia DNA test. I heard something about this before but never was able to find out anything concrete. But this is just another one of many things that call the Stanford team's work into question, at this point it's almost redundant even. This is why I can't wait to see this follow up paper, as I can't imagine what they will possibly come up with...
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 28, 2004, 08:18:09 PM
Quote
and let us not discount the VERY probable idea that the bodies of Elisabeth and Sister Varvara may have been switched so BOTH bodies in Jerusalem should be tested to be certain.


Or that this infamous finger may even belong to someone else, after all we don't even know if it was actually attached to the body in question!
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 28, 2004, 08:47:44 PM
The most glaring problem with Knight's paper, which was mentioned previously here and was affirmed by Reviewer # 1 (provided in a posting above) is the use of Elizabeth's relic as a reference marker.

It is difficult to comprehend why the DNA profile extracted from the relic was used with so much certainity regarding its authenticity, that any scientific analysis to authenticate that sample was not conducted. Blind faith in believing that the relic itself was what the Orthodox Church purported it to be, is a process which undermines standard laboratory practices when comparative analyses form the basis of Knight's inquiry.

It would have been expected by the scientific community, that to use that relic as a key marker to disclaim the authenticity of any other test samples, the relic should have been positively identified first. Only then would it be acceptable to conduct any comparative analyses, and then provide credible conclusions.

Until the relics have been authenticated, one can only suggest that any results obtained are unsafe.
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 28, 2004, 09:46:08 PM
Dashkova,

Why are you so keen to show us these series of photographs and asking for our opinions?  :o

What answers are you seeking I wonder? ???

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 28, 2004, 09:59:02 PM
LOL...Belochka, think absolutely *anything* you like.  I'm just providing any info I have on the Stanford "Claimant", and yes, I do happen to have a few items of interest.

It doesn't matter to me one way or the other whether you share your opinion or if you even have one, with regard to the photos.

However, since there are some who would like to possibly give Litwin's theories a fair go, maybe there are some who see resemblances.  That I do not doesn't make one bit of difference, I just happened to have photos to post.

And by the way, I've had a number of members specifically ask me to post these photos (and others).  It is thanks only to my resident computer scientist who finally took the time to instruct her quite behind the times mother in how to post photos.  I'd been trying on my own for a couple days, as time permitted, with no luck.  As you can see, I've figured it out now, and am able to fulfill the requests of those who wanted to see the photos.

You know, you don't have to look if you don't want to!
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on September 28, 2004, 10:53:08 PM
Dashkova: I think it's fine if you want to post info on the Litwin case under the "Claimants" section. I believe this is enough to establish that he's a claimant.

I find little in the photos convincing FWIW.
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on September 28, 2004, 11:43:45 PM
Dashkova,

All that can be said with confidence is that the image portrays a mature woman holding a young infant. To try and see more into your presentation is absurd.

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 29, 2004, 06:36:49 AM
Lisa, thanks for the tip, I have moved the photos to the "Serious Claimants" thread.

Belochka, you are just jealous because you haven't had the unusual experience of meeting "Tsar Litwin."  I can give you his contact info if that makes you feel more involved.

Your posts are very funny because you always have something in the way of a bunch.  I know this makes you uncomfortable, but it is so entertaining to others, so I hope you continue.

I have posted the photos in another location, should you choose to follow me over there and continue to snipe, just remember that I do and will bite back.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 29, 2004, 09:11:27 AM
Quote
Dashkova,

Why are you so keen to show us these series of photographs and asking for our opinions?  :o

What answers are you seeking I wonder? ???


Belochka, to be fair, some of us did ask Dashkova to post these photos so that we could see what she was talking about as far as this Litwin guy's shenanigans. Sometimes it's just fun to see stuff like that. But having said that, to also be fair, Dashkova, I think Belochka provides some very good insights and arguments about the paper itself, which was what I wanted to hear about in the first place when I made this posting. So this is actually good, we have some balance here on this thread between the serious and the absurd! ;D
Dashkova, these photos look to be of some random Eastern European-looking people that really could be anybody! I have to admit that the "Anastasia" one looks more like the real Anastasia than Anna Anderson did, but she still could be anyone, since she even sort of looks like some of my own ancestors from old photos I have seen! ;)   But the one of "GD Michael" just doesn't cut it at all! If these are the "proofs" that Litwin is going around with, then he is in deep trouble with his claim.  
Basically, to me, Litwin sounds like your textbook run-of-the mill delusional "claimant", the kind we have seen so many of in the past 90 years. No better, no worse. The mystery to me still is, how did he get to latch on to the Stanford team, to co-author their paper, and possibly even have them try to prove him to be a Romanov. This is just beyond my understanding, unless there is something much more than these photos and his stories.  

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 29, 2004, 10:37:30 AM
Quote
The most glaring problem with Knight's paper, which was mentioned previously here and was affirmed by Reviewer # 1 (provided in a posting above) is the use of Elizabeth's relic as a reference marker. It is difficult to comprehend why the DNA profile extracted from the relic was used with so much certainity regarding its authenticity, that any scientific analysis to authenticate that sample was not conducted. Blind faith in believing that the relic itself was what the Orthodox Church purported it to be, is a process which undermines standard laboratory practices when comparative analyses form the basis of Knight's inquiry.
It would have been expected by the scientific community, that to use that relic as a key marker to disclaim the authenticity of any other test samples, the relic should have been positively identified first. Only then would it be acceptable to conduct any comparative analyses, and then provide credible conclusions.
Until the relics have been authenticated, one can only suggest that any results obtained are unsafe.


Belochka,

This was precisly my main point when I wrote to Knight, and still is, but he refused to even discuss it, even though it was a question focused directly on the issues in the present paper and not some future follow up study... He basically hid behind "we are about to publish so I can't discuss anything right now" line...  "Blind faith" is ok for the church, but it doesn't belong in a scientific paper...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 29, 2004, 10:41:06 AM
Ah Helen, as always a voice of reason. Thank you. I agree, Belochka has many, many very good insights, but for some reason she seems to enjoy snipping at anything I type.

I'm afraid I can never agree with some of the things she says, but over all, very insightful and knowledgable about things Imperial.

And yes, I agree with you, typical delusional claimant. His career as a conartist seems to be what led him to convincing (sadly) a scientist.  He believes in his cause completely, often making the remark:  "When I'm king..." (fill in the blank to fit his agenda).

I can't wait to see the "new" article.
Title: Re: New study questions identity of Romanov bones
Post by: AGRBear on September 29, 2004, 12:43:09 PM
Daskova:

Why did Litwin send  you all of this information?

I find this all interesting and have jumped over the "Serious Claimant"  to see the photographs.  

Meanwhile, like everyone else,  I'm waiting for Dr. Knight's papers.

AGRBear

PS-  Once again, Dashkova,  please refrain from thrusting your jabs at Belochka's or at anyone else's opinions.  You are far too intelligent to snip and snipe and I'm sure you'd not make another comments like "your jealous" because you know it's not true.  You were just having a "neck jerk" reaction.

PSS -  Sure am glad you've figured out how to post pictures.  Could you write to me and explain how this is done when you have time.  Please.   Thanks
PSSS - Daskova sent me to a magical place so I can, I hope, place photographs to this forum.  Many thanks.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on September 29, 2004, 01:01:37 PM
AGRBear wrote:
Why did Litwin send  you all of this information?

Because I made myself available and willing to listen to his viewpoints, when few others would.  Like you, I try to be open minded.  When I was finally faced with his "evidence" and actually spent time in his presence, I realized he was delusional.


********
PS-  Once again, Dashkova,  please refrain from thrusting your jabs at Belochka's or at anyone else's opinions.  Comment on what she / he posts.  

****Why don't you invite Belochka to do the same, hmm?  I was *responding* to jabs, and have no reason not to do so, and will continue to do so as needed.

Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 29, 2004, 03:27:15 PM
    Noone here is free if the bad habit of occasionally turning out a sarcastic comment, a bitter jibe or a smart remark (myself especially  ;D) - this is habitual with very inteligent and opinionated people...
      :)     ONE BIG HAPPY Eeehhhh?   :)

   Dashkova really does reserve our respect and our sympathy! The poor lady seems to have known the mysterious "rodger" and has a witness to his delusions for some time.

We'll just have to stay tuned for further announcements.

rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Candice on September 29, 2004, 07:13:17 PM
rskkiya, I have no track record thank you.  Nor have I ever said I was a claimant!  I have my opinions and I share them just as you do.  
Title: Re: New study questions identity of Romanov bones
Post by: pers on September 30, 2004, 05:31:03 AM
As to the remains of Elizabeth that are currently in Russia:  I thought that her body was very well preserved, to the extent of one being able to recognise her.  That is the impression I got from books I have read on Grand Duchess Elizabeth.  Does anyone have a close-up photo of her remains/face?  I thought they would be able to see which is Varvara and which is Elizabeth ???
Title: Re: New study questions identity of Romanov bones
Post by: Olga on September 30, 2004, 06:17:34 AM
(http://img.photobucket.com/albums/v453/Praskovia/myertvyetsi/yelizavetafyodorovna.jpg)
Title: Re: New study questions identity of Romanov bones
Post by: pers on September 30, 2004, 07:35:18 AM
Olga,
You shall agree that it is not really possible to make out much of this photo (of which I am aware), other than it is probably a female...
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 30, 2004, 02:28:40 PM
Quote
As to the remains of Elizabeth that are currently in Russia:  I thought that her body was very well preserved, to the extent of one being able to recognise her.  That is the impression I got from books I have read on Grand Duchess Elizabeth.  Does anyone have a close-up photo of her remains/face?  I thought they would be able to see which is Varvara and which is Elizabeth ???


Hi pers,

In the Stanford paper, they described how GD Elizabeth's body was identified when it was pulled out of the mineshaft. They said that her priest identified the body by the icon around its neck, an icon thought to belong to GD Elizabeth. This implied that a few months after her death (they recovered the body some time in October 1918, I believe), the body was not readily recognizable. But whether you can recognize the body or not is not even the point here, since we don't really know if the finger in question was attached to it or not. That was never established as far as I know. I tend to believe that it may not have been, because I don't think they would be prying it off the body many years afterwards if it were intact to begin with. So even if this body does belong to GD Ella, the finger may not. The whole point is that the Stanford team did not scientifically establish whose finger this was before they used it as a reference for their DNA tests....

Helen
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 30, 2004, 02:31:34 PM
Previet Olga,

I can't really make out what the photo you posted was of... a body? a cloth?

Candice-- come on-- you spent so much time here months ago with your elaborate hints about survivors on the claimants thread - then offered us nothing...Now you have claimed that Alice of Hesse was not Alixandra's mother! And where - I wonder - is your proof? You know evidence?  Hmmm?

it doesn't look good dear...
rskkiya.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 30, 2004, 02:36:45 PM
Quote
Candice-- come on-- you spent so much time here months ago with your elaborate hints about survivors  then offered us nothing...Now you have claimed that Alice of Hesse was not Alixandra's mother! And where - I wonder - is your proof? You know evidence?  Hmmm?

it doesn't look good dear...
rskkiya.


Hey, I have an idea...why don't you guys start a new thread where you can deck this out  ;D

Candice, where on earth did you get the notion that Alexandra was not Alice's biological daughter? You have to admit that this is a really odd statement.

Helen
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 30, 2004, 02:42:41 PM
Helen

I am sorry. ( :()  I will try to keep on topic.

filled with remorse ;)
rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 30, 2004, 02:48:10 PM
Quote
Helen

I am sorry. ( :()  I will try to keep on topic.

filled with remorse ;)
rskkiya


It's ok... don't do it again  ;) :D
Title: Re: New study questions identity of Romanov bones
Post by: IlyaBorisovich on September 30, 2004, 03:40:21 PM
Sorry if this seems too obvious, but does anyone know where the supposed remains of Varvara were interred?  It might be a worthwhile endeavor to exhume her and test her DNA.  If the remains were misidentified when the bodies were recovered, then this test would so indicate, and put this whole matter to rest.

Ilya
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on September 30, 2004, 03:49:39 PM
Ilya: You are refreshingly naive if you think any of these matters will EVER be put to rest!

Varvara is buried in Jerusalem along with Ella. That is why we have said all along that it is far more likely the finger in question is hers rather than Ella's.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on September 30, 2004, 07:02:50 PM
Quote
Sorry if this seems too obvious, but does anyone know where the supposed remains of Varvara were interred?  It might be a worthwhile endeavor to exhume her and test her DNA.  If the remains were misidentified when the bodies were recovered, then this test would so indicate, and put this whole matter to rest.

Ilya


Lisa is right, unfortunately based on what we have seen so far I don't think testing Varvara's remains would do the trick of putting this matter to rest. What they should have definitely done, but failed to, was to positively id this finger one way or the other, before using it as a reference in their research and making all kinds of claims based on that. Why they didn't do something so basic can only be guessed about....  ???
Title: Re: New study questions identity of Romanov bones
Post by: Candice on September 30, 2004, 07:14:06 PM
DNA testing still hasn't proven the identity of either Elizabeth or Alexandra.  I have always had the impression from the research published that the Russians are hiding the truth.  The only way this mystery can be solved is if Forensics analyse Barbara and Elizabeth's remains. Ofcourse that is if Elizabeth's body is really there in Jerusalem.

Title: Re: New study questions identity of Romanov bones
Post by: Candice on September 30, 2004, 07:21:15 PM
rskkiya, I continue to maintain my belief that at least two of the children did survive.

Candice




Quote
Previet Olga,

I can't really make out what the photo you posted was of... a body? a cloth?

Candice-- come on-- you spent so much time here months ago with your elaborate hints about survivors on the claimants thread - then offered us nothing...Now you have claimed that Alice of Hesse was not Alixandra's mother! And where - I wonder - is your proof? You know evidence?  Hmmm?

it doesn't look good dear...
rskkiya.

Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 30, 2004, 09:17:18 PM
Candice
Lets keep that topic in Serious Claimants
This is another subject.
R.
Title: Re: New study questions identity of Romanov bones
Post by: neva on September 30, 2004, 09:21:59 PM
Reading the posts about Elizabeth's body not being recognizable a few months after her death... how long does it take for a dead body to decompose? I thought it was 2-3 weeks.
Sorry for the question.

neva
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on September 30, 2004, 09:32:19 PM
  Decomposition rather depends on the environment ... in a swamp a body may quickly bloat and may be partially consumed by predators. In a desert or a very dry environment it could quickly loose moisture, but if in a cold or frozen situation it may become 'freeze dried!"
  I am not aware of the environment in which the body was recovered (I heard she was thrown down a mine shaft - but I'm not sure of this)
R
Title: Re: New study questions identity of Romanov bones
Post by: ashanti01 on September 30, 2004, 10:40:02 PM
Ella was found in a mine shaft, but it was said that her body was preserved and seemed only "dried up" or at least that was what Ella's sister wrote when discribing the conditions and matter in which her body was taken to its final resting place.
Title: Re: New study questions identity of Romanov bones
Post by: pers on October 01, 2004, 05:35:26 AM
Thank you Ashanti01!
That is exactly how I have it.  I think that comes from the book on Elizabeth by Lubov Millar too.  It is possible that the remains can be that well preserved.  I also recall having read that her corpse was hanging in the air over a steel beam in the mine shaft - apparently when she was thrown in, her fall was stopped by the beam on the way down, and that is where she stayed  until her body was retrieved.
Title: Re: New study questions identity of Romanov bones
Post by: pushkina on October 01, 2004, 05:45:33 AM
but how is that possible? as she was supposed to have bandaged one of the grand dukes' head before he died?
Title: Re: New study questions identity of Romanov bones
Post by: pers on October 01, 2004, 07:28:11 AM
The only explanation I can offer you is that more than one of the people thrown down the shaft struck the steel beam(s) on the way down. :'(
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 01, 2004, 09:34:51 AM
Quote
Ella was found in a mine shaft, but it was said that her body was preserved and seemed only "dried up" or at least that was what Ella's sister wrote when discribing the conditions and matter in which her body was taken to its final resting place.


I guess it's possible that the conditions in that mineshaft were such that all the bodies were preserved in such a way. That still doesn't really mean that the bodies were readily recognizable, otherwise Elizabeth's identification when the body was recovered would have been based on its appearance rather than on the icon around the neck the way it was described... Don't you think?
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 01, 2004, 10:13:19 AM
Most importantly, we really do not have a good first hand account of the finding of the bodies, most of what we know is really "hearsay" without good evidence. Both bodies in Jerusalem must be tested to get a definitive answer.
Title: Re: New study questions identity of Romanov bones
Post by: IlyaBorisovich on October 01, 2004, 10:47:17 AM
Quote
Most importantly, we really do not have a good first hand account of the finding of the bodies, most of what we know is really "hearsay" without good evidence. Both bodies in Jerusalem must be tested to get a definitive answer.


Which is exactly what I suggested.  I actually consider myself to be quite a cynic rather than refreshingly naive.  Perhaps I should have stated more emphatically that testing Varvara's body would scientifically put the matter to rest.  There will always be those who will not believe anything but what they want to believe.  I'm truly not as naive as THAT.

Ilya
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 01, 2004, 12:18:19 PM
Quote

Perhaps I should have stated more emphatically that testing Varvara's body would scientifically put the matter to rest.  
Ilya


One would think that would be the case, but as everyone has witnessed with the Anna Anderson case and especially this latest Romanov bone controversy, testing the Jerusalem bodies may not even put this to rest scientifically!  :( There will likely be some scientists out there who will question these tests too.... Looks like we have to resign ourselves to the fact that this will never be put to rest, no matter what, as far as some people are concerend  :o
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 01, 2004, 02:39:27 PM
The identity of Alexandra's remains are not in question scientifically, Candice. We know who the matrilineal descendants of QV are - there are even books about them. We know what the mtDNA profile of matrilineal descendants of QV looks like from tests on living descendants. We know that there was a matrilineal descendant of QV and 3 of that descendant's daughters found in a crude grave in the Koptyaki Forest. We know the testimony of the murderers of the Imperial Family that their remains were placed in the Koptyaki Forest. Since we can account for the descendants of QV, none of whom besides Alexandra were murdered and buried there, we know that those remains were hers. Without question.
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on October 01, 2004, 04:14:44 PM
Candice I'd still like to know why you think Alix wasn't Alices daughter.I still can't wrap my mind around that one. :-/
Title: Re: New study questions identity of Romanov bones
Post by: ashanti01 on October 01, 2004, 07:25:14 PM
I believe a body can be preserved based on the elements and treatment of the body.

As for the bodies that are currently in Jerusalem, I have to agree that the best thing that could be done is for them to be tested and tested right.

In "Elizabeth: Grand Duchess of Russia" the author wrote that Ella's body was very well preserved after it was cleaned. The man who took the body to Jerusalem wrote to Ella's sister telling her how he was forced to open Ella's coffin and to his suprise the body was not decomposed but seemed only dried up.

I cannot say whether or not this is true but this seems to be the closest thing to confirmation I have read reguarding the state of the body.

Does anyone know what happened to the rest of bodies pulled from the shaft?
Title: Re: New study questions identity of Romanov bones
Post by: Annie on October 01, 2004, 07:52:36 PM
Quote
Does anyone know what happened to the rest of bodies pulled from the shaft?


There are pictures of those too. They were all buried, along with Ella, in an Orthodox shrine in Peking, China. Ella and Sister Varvara were of course moved to Jerusalem. The shrine was later destroyed to build the Soviet embassy. I have seen reports that the bodies were moved to Jerusalem with Ella, and also that they were dumped with the debris of the shrine. I hope the second is not true :'(
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on October 01, 2004, 08:50:13 PM
I really hope that they will test both Ella's and Sister Varvara's remains so we can at least clear up the mystery with the finger.It just suprises me they havent done that before now unless the church where their remains are kept are not willing to have this done.
I can understand that reasoning as their bodies are considered relics but it is aggravating nonetheless.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 01, 2004, 10:03:54 PM
Quote
I really hope that they will test both Ella's and Sister Varvara's remains so we can at least clear up the mystery with the finger.It just suprises me they havent done that before now unless the church where their remains are kept are not willing to have this done.
I can understand that reasoning as their bodies are considered relics but it is aggravating nonetheless.


Merrique,

I have a very strong feeling that a lot of this reasoning would be as much political as it is religious. There are obviously ways to skirt around the religious issues, after all, the church often allows this type of thing. It did allow the finger to be tested in this last study even though it is considered to be a relic, but perhaps it just depends on the purpose behind the testing. And suppose they test the body and the tests show that it is not Elizabeth, then what? This would open up a big unwanted can of worms... This is why I don't see this testing happening any time in the near future...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 01, 2004, 10:09:38 PM
Quote
Candice I'd still like to know why you think Alix wasn't Alices daughter.I still can't wrap my mind around that one. :-/


Yes, I'll second that. Candice, you can't just throw out a statement like that and not elaborate on it. Where did that come from  ???...
Title: Re: New study questions identity of Romanov bones
Post by: ashanti01 on October 01, 2004, 11:50:04 PM
Quote

There are pictures of those too. They were all buried, along with Ella, in an Orthodox shrine in Peking, China. Ella and Sister Varvara were of course moved to Jerusalem. The shrine was later destroyed to build the Soviet embassy. I have seen reports that the bodies were moved to Jerusalem with Ella, and also that they were dumped with the debris of the shrine. I hope the second is not true :'(


Thank you Annie

I had heard that some of the bodies were buried in a shrine which was destoyed and I also heard that the priest/follower/man who took Ella body to Jerusalem lost a few bodies during his attempt to take them to Jerusalem.

I too hope this is not true...

Does anyone know if any photos were taken of the bodies after they were found? Or the mine shaft itself?
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 02, 2004, 09:17:28 AM
First,
The silly notion that Alix was "not" the actual daughter of Alice came from a claimant who appeared on here. He raised that "notion" because he had to try to explain why his mtDNA was excluded from relation to Alice. He had a remote ancestor who had some "possible" relation to Nicholas, so he concocted the story that Alix was "actually" the undisclosed daughter of Queen Alexandra of England who gave the child to Alice to raise as her own.
When his story was called "ludicrous" he threatened to sue use for slander/libel, so we just removed the whole thing from the forum.

Second,
Actually, no one has ASKED to test the two bodies in Jerusalem...From our sources, we have been told that the Church probably would be happy to permit the testing. They ARE relics, and as such, proper identification of the saints is important to the church.  The major problem is actually who will pay for the tests, and insure proper handling and chain of custody along the way.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 02, 2004, 09:48:37 AM
Quote
First,
The silly notion that Alix was "not" the actual daughter of Alice came from a claimant who appeared on here. He raised that "notion" because he had to try to explain why his mtDNA was excluded from relation to Alice. He had a remote ancestor who had some "possible" relation to Nicholas, so he concocted the story that Alix was "actually" the undisclosed daughter of Queen Alexandra of England who gave the child to Alice to raise as her own.
When his story was called "ludicrous" he threatened to sue use for slander/libel, so we just removed the whole thing from the forum.

Second,
Actually, no one has ASKED to test the two bodies in Jerusalem...From our sources, we have been told that the Church probably would be happy to permit the testing. They ARE relics, and as such, proper identification of the saints is important to the church.  The major problem is actually who will pay for the tests, and insure proper handling and chain of custody along the way.


The notion of Alix not being Alice's "real" daughter becomes even sillier if you remember the fact that Alix was the carrier of a hemophilia gene which she passed on to Alexei, and which was passed on to her by her mother, Alice, who got it from her mother, Queen Victoria...

This is true, DNA tests and the work that goes into doing them can get quite expensive, so yes, even if the church is willing to give permission to go through with it, someone will have to come up with the money to fund it. If the church seriously wants to get the answers to this, would they be willing to fund this testing do you think? I am sure that proper chain of custody and handling can be arranged once the financial aspects are in place... But things can still get politically sticky when it comes down to deciding who will do the testing: it would have to be someone seen as completely impartial to the whole thing so as to prevent any criticism from any side later on, when the results are in...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 02, 2004, 02:17:55 PM
Helen..nice point about the hemophelia gene passed on by Alice to Alexandra.

I wonder if this speculation about Elizabeth's finger  or Alexandra's real mother (a-la Candice & you know who mentioned by the FA ) could be settled if a Hemophelia gene was found in Alexandra's bones. I hope the proposed testing includes this.

I'm sure it would shut everyone up finally.

Best regards. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 02, 2004, 03:28:41 PM
Hi Lisa.

I have this image in my mind that you are the keeper of the mystical gate and I still don't have the key or keyword which would allow me to get through.

I am still under your microscope, I know, but I have to make an observation from one of your posts.

You mentioned that Princess Katherine of Yugoslavia and Prince Phillip had matching DNA, and that is true. This proves that THEY are related. But! How does that disprove Dr. Knight's conclusions that the DNA obtained from the Koptiaky forest was unacceptable due to contamination of that sample.

I believe you said that the above two matched the DNA of the bones obtained from the forest so Litwin/Rodger were wrong/ had no claim.

Now I don't much care for either Litwin or Rodger or both of their claim(s).

I do believe though that Dr. Knight's research counters the DNA findings on the bones from the Koptiaky forest due to contamination so, how can you present Prince Philip and Princess Katherine's DNA as any kind of proof that Dr. Knight's research is wrong? Or, that the bones, under the circumstances, are even those of the Imperial Family?

Best Regards. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: AGRBear on October 02, 2004, 03:53:07 PM
Quote
 .... [ine part] ....Hi Lisa.

I have this image in my mind that you are the keeper of the mystical gate and I still don't have the key or keyword which would allow me to get through.

I am still under your microscope, I know, but I have to make an observation from one of your posts.

Best Regards. JonC.


I discovered there are many gates through which you will enter and there are what I call "guardians" of those gates.  They do not mean any harm.  They just like it best when you agree with them.
;D

AGRBear

[One who has walked through some of the gates with  differences of opinion or have just tried to discover and understand all the great information people have on ths forum.]

PS  Sorry - After reading my post,  I found it a bit harsh and my attempt of humor may not have been understood.  The "guardians" are not out to "get you, me or anyone" what they do like is  seeing evidence,  passsages from books, doctuments and letters on the subject.  
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 02, 2004, 04:35:41 PM
Quote
You mentioned that Princess Katherine of Yugoslavia and Prince Phillip had matching DNA, and that is true. This proves that THEY are related. But! How does that disprove Dr. Knight's conclusions that the DNA obtained from the Koptiaky forest was unacceptable due to contamination of that sample. I believe you said that the above two matched the DNA of the bones obtained from the forest so Litwin/Rodger were wrong/ had no claim.
I do believe though that Dr. Knight's research counters the DNA findings on the bones from the Koptiaky forest due to contamination so, how can you present Prince Philip and Princess Katherine's DNA as any kind of proof that Dr. Knight's research is wrong? Or, that the bones, under the circumstances, are even those of the Imperial Family?

Best Regards. JonC.

Hi JonC, I would like to respond to this if I may. I think that the reason Lisa presented Katherine's DNA as proof is, and correct me if I'm wrong - this is the way I understood it, because someone was saying that Prince Philip's DNA was not really his DNA since it didn't match the finger's DNA? So the point was to show that Prince Philip's DNA sequence was really his because it also matched another maternal relative. Of course the fact that Katherine's DNA matched Philip's does not prove anything other than they have the same maternal line and both descended from Queen Victoria and not that the bones belonged to the IF. However, the bone contamination theory would only work if the contaminating was done by another maternal descendant of Queen Victoria because the DNA matched those two. Yes, to the general audience the contamination theory sounds very plausible but if you have a little more in-depth knowledge of the way this works, you would understand how unlikely or even impossible this scenario is. If you go back to the beginning of this thread and re-read my letter to Knight, you will see that I have already addressed this same issue with him. But let me do it again. In order for the contamination theory to make any sense whatsoever, one of two things would have to have happened. If the contamination was accidental, then the person who accidentally contaminated these bones would have to have had the same mitochondrial DNA as Prince Philip and Pss Katherine, i.e. Queen Victoria's mtDNA. The chances of that kind of a coincki are extremely slim, in fact, I would say practically none. I have to add here that when particular DNA samples get contaminated with someone else's DNA, you won't get a clear result that will match your reference (control) DNA or any other DNA for that matter, what you will get is something that looks very weird and you will know immediately that your sample was contaminated. Therefore, if these bones are not really the IF, this brings us to the second option, which would be that the samples used to test these bones were contaminated or rather substituted deliberately, with samples that matched the mtDNA of Queen Victoria's descendants. For that to be true, many people would have to have been involved in this conspiracy including, I think, the scientists who did the tests. So the only way to accept the contamination theory would be to accept that it was done deliberately, i.e. conspiracy. Do you think that this is what happened? I am not being fascetious, JonC, I am seriously asking if you think that this is a possibility? I personally am having a very hard time believing that a bunch of western scientists who really didn't care all that much about whose bones these were in the first place would have gotten themselves involved in this kind of a conspiracy, putting their hard earned professional reputations on the line. Of course anything is possible, but is it reasonable to believe this? These are almost the same allegations as those they made in the OJ Simpson trial, and that of course was absurd. With all due respect to Dr Knight, who did do a very professional job with the technical part of his DNA testing, fact still remains that he did not seem to follow the basic scientific protocol of positively identifying his control DNA, i.e. the finger. So if we are going to question the science part of either research, I would tend to question that a lot more than what he challenges in Gill's. The only thing in Gill's results that we can seriously question is the length of his ancient DNA segments, which is unusual but not, from what I understand, impossible to achieve. But, unless Dr Knight can prove whose finger he used as a reference scientifically, he really doesn't seem to have all that much of a case... at least not as far as I can see... I hope this helped you, somewhat, to understand this "contamination theory" ...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 02, 2004, 04:53:12 PM
Quote

They just like it best when you agree with them.
 ;D

AGRBear

[One who has walked through some of the gates with  differences of opinion or have just tried to discover and understand all the great information people have on ths forum.]



AGRBear,

I, for one, welcome opinions different than my own, in fact I love it when someone is able to win me over to their side with logic! In this case, this hasn't happened yet, not sure if it will, unless something earthshattering is presented in the new Knight paper ;D
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 04, 2004, 09:33:33 PM
Thank you, Helen, for a beautiful summation of the mtDNA situation.

Jon C, I am flattered that you consider me some type of gatekeeper, but I have no wish to exclude you or anyone else from a search for or access to the truth. To be clear, the only issue I ever had with you was when you weren't acknowledging that Kiril was not directly commanding the troops at Tsarskoe Selo at one point- and I think this was on another thread!

Rodger/Litwin did indeed challenge the mtDNA identification of Alexandra and the grand duchesses in the Koptyaki grave - implying that Prince Philip's mtDNA was somehow faked. Fewer than 10 people had any knowledge of the tests done on Katherine of Yugoslavia - her sample in fact pre-dated PP's. So, if there had been any funny business with his sample, hers would have shown it. The significance of Katherine's sample is thus two fold - it unintentionally provided scientists with a "control" sample of Victorian mtDNA AND, since it was not known that this testing was going on, it would short circuit attempts by psudo scientists such as Litwin to allege a conspiracy by UK scientists with the DOE's sample. (Which is in fact exactly what Litwin did when he came to the board.)

The US scientists I spoke to - ironically this testing was all due to yet another claimant! - told me that the remaining Victorian descendants were all accounted for. So, if I could produce a male with matching mtDNA it would likely be Alexei and a female it would likely be the missing grand duchess. I am not a scientist - but this is what scientists have told me. And, I do consult them because I do work with claimants under certain conditions.

None of the scientists I have spoken to are favorable about Dr. Knight's report. And, this was before we found out that Rodger/Litwin had managed to get his name on Dr. Knight's paper! Since we have offered Dr. Knight the opportunity to clear this up for us and he has not, I have to conclude that there is something indeed wrong with his paper. I am willing to wait a short time for his promised response before concluding he was either a willing or unwilling dupe of Litwin/Rodger.

So, Jon, I hope this and Helen's very detailed explanation answers your questions of me.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 04, 2004, 09:47:17 PM
Helen_azar

regarding contamination, certainly all of the possibilities you mentioned could have taken place. The one which seems more plausible , to me, at least is the one where 'blood ' was added to the samples.

You might ask 'where did the new blood come from?' well it could have been Prince Philip's own blood since they did draw his blood to compare the DNA from the bones. I know this may sound off the track but it is possible.

Dr. Parsons from DOD said that the bones had enough DNA material because they were burried in an area of permafrost which would preserve the DNA. He was corrected when told that the burrial site did experience 100 degree weather. Over a period of 80 years that's very little protection.

It has been, I think, mostly accepted that the perfect results..I don't remember how many base pairs from both HVR1 and HVR2..could not have been achieved from the poor samples studied by the respective scientists. So! There it is!

I contend that if another study is not done by a responsible, independent non partisen group we may never even know if we have the remains of the Tsar or his family for certain.

There are just too many questions raised by all the scientists themselves. Now if you say..'were all those renown scientists crooks/messing with our minds. I have no idea there but I know that Politics does make for strange bedfellows. Best regards. JonC.

Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 04, 2004, 09:52:18 PM
Lisa.

I guess then we all have to wait and see. Thanks for your reply. You mentioned 'another claimant' responsible for the new testing. What other claimant? JonC.
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 04, 2004, 10:02:47 PM
Jon: I was contacted by a family in the 1990's who felt their late mother was the missing grand duchess. I saw photos of this woman and she was a dead ringer for Tatiana. I reviewed their case and testing done through Brown University. The mtDNA testing results were negative in terms of a match with the Victorian mtDNA. They did manage, however to assist the investigation of the Koptyaki remains in the manner I have outlined previously.

It was an interesting case and while the outcome was not what they expected, I found the experience compelling.
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 05, 2004, 12:02:10 AM
Jon:

But studies have been done by impartial laboratories! Trouble is, people want to keep stirring the pot and creating controversy. And still we find that there are people like Dr. Knight who apparently is able to be manipulated by questionable claimants.

I thought that science had settled most of these issues. To me, the only thing that is open is where Alexei and his missing sister are. I am distressed that poor scientists have managed to stir the pot and create doubt where none should exist. I am mostly distressed by the fact that a dear friend literally gave his life for the identification and burial to happen and yet still - needless questions.  There are still people who will question just so they can question - the sacrifices of others be damned, I guess. It's really sad when you really think about it.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 05, 2004, 07:22:51 AM
Quote
Helen_azar

You might ask 'where did the new blood come from?' well it could have been Prince Philip's own blood since they did draw his blood to compare the DNA from the bones. I know this may sound off the track but it is possible.  

Dr. Parsons from DOD said that the bones had enough DNA material because they were burried in an area of permafrost which would preserve the DNA. He was corrected when told that the burrial site did experience 100 degree weather. Over a period of 80 years that's very little protection.

It has been, I think, mostly accepted that the perfect results..I don't remember how many base pairs from both HVR1 and HVR2..could not have been achieved from the poor samples studied by the respective scientists. So! There it is!

I contend that if another study is not done by a responsible, independent non partisen group we may never even know if we have the remains of the Tsar or his family for certain.

There are just too many questions raised by all the scientists themselves. Now if you say..'were all those renown scientists crooks/messing with our minds. I have no idea there but I know that Politics does make for strange bedfellows. Best regards. JonC.



JonC,

I don't know if you are aware of this, but when they initially got the results for the DNA sequence assumed to be the tsar's, and compared it to his maternal relatives, there were some questions about these bones too because one of the base pairs did not match the mtDNA of the relative. The reason for this was explained by the scientists at the time: heteroplasmy, a rare but not impossible condition where a sponteneuos mutation took place in one of the base pairs, probably in Nicholas's mother's DNA. Of course those who wanted to be skeptical about the whole thing now had something to rally around, and of course this mismatch should have been questioned and doublechecked. After lots of various arguments and speculations with no satisfactory resolution, the scientists were able to get permission to exhume the body of Grand Duke Georgi who was interred at St P&P fortress (this was several years after the initial tests took place). GD Georgi is Nicholas II's brother as you know, so his mtDNA should match Nicholas's exactly. And it did. Exactly. Including the heteroplasmy, showing that these scientists were correct about that. For some reason these particular results, which were also published in Nature Genetics, were not really publicized that much, but I have read it and I know this was done for a fact. Of course  you will now say that this may have been a conspiracy too, and that they substituted Georgi's samples, or something like that. In which case, if conspiracy was the name of the game from the get-go, and according to this theory it had to be, then why didn't these scientists make Nicholas's DNA match exactly to the relative's in the first place and opened themselves up for challenges? If this were really a conspiracy, you would think they would have made sure everything matched perfectly right from the beginning, wouldn't you? But they had to wait several years until the test on GD Georgi's mtDNA was allowed before they could put an end to the challenge about Nicholas II's bones. When no one could question Nicholas's bones any longer, that's when the questions about Alexandra's and the daughters' bones began. But is it possible that Nicholas's bones were his and the rest were some random ones? I doubt it. So, JonC, when you say all these things are "possible", you have to think about a bunch of other things involved and take those into consideration, and then decide if it is "plausible". There is a difference, you know, between these two terms. There are so many factors involved, and for all this to be a conspiracy, all of them would have to altogether make sense, and they just don't, if you really think about it. Believe me, I personally have nothing invested in any of this, whichever way it turns out, in fact, I was the  one who said lets look at everything with an open mind, lets give Knight the benefit of the doubt. But from what I can see so far, most of the arguments in favor of a conspiracy seem to be "red herrings", and that this conspiracy theory is just too far-fetched to be plausible.  JonC, I have learned that when it comes to science or medicine, if it looks like a duck and walks like a duck and quacks like a duck, it usually is a duck, and almost never is anything more sinister.... Or if you hear the sound of hooves on the pavement, most likely it is a horse and not a zebra. I believe that in this case, this too is a duck, or a horse - take your pick. But like you, I am still going to wait very impatiently to see what Dr Knight's new paper will present to us.

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Annie on October 05, 2004, 09:26:20 AM
Quote

JonC,

I don't know if you are aware of this, but when they initially got the results for the DNA sequence assumed to be the tsar's, and compared it to his maternal relatives, there were some questions about these bones too because one of the base pairs did not match the mtDNA of the relative. The reason for this was explained by the scientists at the time: heteroplasmy, a rare but not impossible condition where a sponteneuos mutation took place in one of the base pairs, probably in Nicholas's mother's DNA.Helen


Who was this relative, wasn't it Xenia Sfris, daughter of Bebe Yussoupov, who was the daughter of Felix and Irina, and thus the maternal line of her, Bebe, Irina, Xenia A. and Marie? If this is the one who didn't match, could it be that she was adopted and didn't know it? I have always wondered about her because she doesn't look a thing like anyone else in the family, blonde, her mouth, her build. Maybe she took all after the Shemeretev side of the family, but I wondered if maybe she was adopted because they didn't have her for 5 years after they were married and that was unusual for a couple in those days, plus N. Shemeretev had been ill with TB. If for whatever reason they were unable to conceive, they may have had a hush hush adoption no one, even the girl herself, ever knew about. I hope not, because if that's true it means the Yussoupov bloodline is now extinct:( Any thoughts on this speculation?
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 05, 2004, 09:48:16 AM
Forgive me Annie, but I do think that the results from Ms. Sfiris did in fact match up with the other mDNA tests. Of course I did read this some years ago so if there was a "problem" I'm not aware of it.

cat Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 05, 2004, 10:02:28 AM
Quote

Who was this relative, wasn't it Xenia Sfris? If this is the one who didn't match, could it be that she was adopted and didn't know it? I have always wondered about her because she doesn't look a thing like anyone else in the family, blonde, her mouth, her build. Maybe she took all after the Shemeretev side of the family, but I wondered if maybe she was adopted...  I hope not, because if that's true it means the Yussoupov bloodline is now extinct:( Any thoughts on this speculation?


Hi Annie,

I think they did use Xenia Sfiris's DNA, but what I forgot to mention in my previous post was that some of the DNA, that was assumed to be Nicholas's, did match exactly to the control, and some of it didn't, and I think this is the way heteroplasmy works. In other words, there are two types of DNA sequences there, some that match exactly to other maternal relatives, and some that have one base pair that is different. It just depends which sample they used from the bones, there were two types of DNA sequence there. I know it sounds kind of weird, but this is the way heteroplasmy works. So in Grand Duke Georgi's DNA, they saw the exact same thing! I also seem to remember, and I may be wrong about this, that they used Nicholas' other maternal line relatives, the Danish ones, and the result was the same, one base pair difference for some of the DNA and an exact match for other. You have to remember that even with the heteroplasmic sequence only one base pair was different, the rest of the sequence was identical, and this sounds like a case of heteroplasmy, from what I understand. Generally, if the person whose DNA is used for reference is unrelated, the sequence would have more than one or two discrepancies, but here it was just that...which shows that it was most likely a mutation rather than a mismatch. As far as for Xenia's looks, genes are a funny and complicated thing, sometimes "phenotypes" will show themselves after a few generations of sitting dormant, so you can't really judge by that.
So... although it would make for an interesting soap- operish twist, I don't think Xenia was adopted  and Felix's bloodline is quite safe ;)  

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 05, 2004, 10:10:32 AM
Here is the original article, so we can use facts not speculations:
Mitochondrial DNA sequence heteroplasmy in the Grand Duke of Russia Georgij Romanov establishes the authenticity of the remains of Tsar Nicholas II.

Ivanov PL, Wadhams MJ, Roby RK, Holland MM, Weedn VW, Parsons TJ.

Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow.

In 1991, nine sets of skeletal remains were excavated from a mass grave near Yekaterinburg, Russia which were believed to include the Russian Tsar Nicholas II, the Tsarina Alexandra, and three of their daughters. Nuclear DNA testing of the remains verified such a family group, and mitochondrial DNA (mtDNA) sequences of the presumed Tsarina matched a known maternal relative, Prince Philip. mtDNA sequences from bone of the presumed Tsar matched two living maternal relatives except at a single position, where the bone sample had a mixture of matching (T) and mismatching (C) bases. Cloning experiments indicated that this mixture was due to heteroplasmy within the Tsar; nevertheless, the 'mismatch' fueled a lingering controversy concerning the authenticity of these remains. As a result, the official final report on the fate of the last Russian Royals has been postponed by Russian authorities pending additional, convincing DNA evidence. At the request of the Russian Federation government, we analysed the skeletal remains of the Tsar's brother Georgij Romanov in order to gain further insight into the occurrence and segregation of heteroplasmic mtDNA variants in the Tsar's maternal lineage. The mtDNA sequence of Georgij Romanov, matched that of the putative Tsar, and was heteroplasmic at the same position. This confirms heteroplasmy in the Tsar's lineage, and is powerful evidence supporting the identification of Tsar Nicholas II. The rapid intergenerational shift from heteroplasmy to homoplasmy, and the different heteroplasmic ratios in the brothers, is consistent with a 'bottleneck' mechanism of mtDNA segregation.

You can read the full text here:
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8630496&dopt=Abstract
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 05, 2004, 12:59:34 PM
Thanks for posting the abstract, FA. I am actually kind of impressed that I remembered that much detail about this paper, since I read it at least three years ago or even more! Basically it summarizes what I just said, so there you have it...  :)  
P.S. JonC, did you catch the part about "Nuclear DNA testing of the remains verified such a family group..."? So, if your contamination conspiracy theory is legit, somehow the conspirators would have had to set this up so that not only does the mtDNA match that of Philip's, but also that the nuclear DNA from the same samples is consistent with the three younger females being the progeny of one of the older females (alleged Alexandra) and one of the males (assumed to be the Tsar). And, at the same time, the forementioned male's mtDNA would have to match that of GD Georgij, including the heteroplasmy part. Are you still following this, Jon? And, they would have to have done all this in such a way that the peer reviewers from one of the most prestigious scientific journals, Nature Genetics, would not suspect a thing... These conspirators must be real geniuses, I mean, that is a lot to orchestrate for a single conspiracy, especially one that really doesn't seem to have any obvious purpose  ;). The way I see it, the burden of proof is now on whomever is trying to prove that Gill's data is a result of intricate conspiracies... but so far these people have done a very poor job of proving it.

But perhaps we will see something more substantial in Knight's new paper....

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Annie on October 05, 2004, 01:28:15 PM
Thanks for the explainations:)
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 05, 2004, 04:07:12 PM
The mtDNA testing done to prove Nicholas II was in the Koptyaki grave was done from the following sample donors:

Xenia Sfiris (matrilineal descendant of Maria Feodorovna)
The Duke of Fife (matrilineal descendant of Louise of Hesse Cassel, mother of MF)
George Alexandrovich (brother of Nicholas II)

This is satisfactory proof for me. I will not, however, be surprised if someone says they want more "impartial" testing.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 05, 2004, 04:32:28 PM

Quote
I will not, however, be surprised if someone says they want more "impartial" testing.


Lisa,

Thanks for providing the list of donors, so they did use one of the Danish relatives, like I thought.

I hate to say this, as I kept hoping this was not the case here, but I am beginning to realize that in this instance, just being involved as an "impartial party" will make one automatically "partial" by default, according to one side or another. So no matter how disinterested someone may be, the minute he or she gets involved in this case, he or she will be seen as having some sort of an agenda by some.... Therefore, there seems to be no such a thing as an impartial participant... therefore there will probably never be a satisfactory agreement among the parties  involved :(
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 05, 2004, 04:38:57 PM
Quote
Helen_azar

regarding contamination, certainly all of the possibilities you mentioned could have taken place.  JonC.



Jon, I just re-read your previous post and realized, based on the above statement alone, that you basically didn't understand a word I said...  :(  I give up.  :-/
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 05, 2004, 10:22:09 PM
Helen: I hear what you are saying about partial and impartial, but hopefully at some point, sanity will prevail. The scientists I have spoken to who do this type of testing are emphatically impartial. I think that sometimes people don't understand how difficult and expensive this type of testing is. Maybe they don't like the results, so they may say - let's have some impartial testing, when in fact, impartial testing has already been done at great trouble and expense.

I have come to believe as you do that we will not be able to resolve this to everyone's satisfaction. For me, the ultimate truth is that no one who was close to the IF ever saw them again after Ekaterinburg.
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 06, 2004, 01:14:11 AM
How very true Lisa!

I have always firmly believed that had anyone remotely survived such a brutal massacre, the Dowager Empress would have been accorded the simple courtesy of being reunited with any survivor during her period of exile both in the Crimea and abroad.

She remained in hope to her last day! :'(

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 06, 2004, 06:36:13 PM
Quote
Helen: I hear what you are saying about partial and impartial, but hopefully at some point, sanity will prevail. The scientists I have spoken to who do this type of testing are emphatically impartial. I think that sometimes people don't understand how difficult and expensive this type of testing is.


Yes, I certainly know that it isn't easy or cheap or quick to do this kind of testing. And yes, most scientists are impartial to this sort of thing, because they too usually want to get the right answers. So hopefully you are right and common sense will eventually prevail in all this. After all, we all have the same goal here, and that's to find out the real facts. Well, maybe not all, but most of us anyway  ;).
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 07, 2004, 05:27:03 PM
Hello, I am a new member and have been enjoying this discussion topic. I am totally agree with Helen because of four reasons.

1)      The whole argument by Alec Knight hinged on the assumption that the Elizabeth’s finger is more authentic than Alexandra, which is not true, as helen said.

2)      Even with elaborate hoax which they suspect, it is impossible that all mtDNA P Gill analyzed matched to Prince Philips, as helen said.

3)      In science, it is difficult to prove the “non-existence” of something. All Knight’s data about “how impossible to obtain a long PCR product” is anecdotal. Remember you need only one positive example to disprove the non-existence premise (To refute the claim “there is no white crow”, all you have to do is to find one white crow.) In this case, P Gill’s paper itself is the white crow, as helen said.

4)      Alec Knight’s rebuttal was never published in Nature Genetics or in any prestigious paper. Remember, the notorious 94’s study that showed that Dinosaur’s DNA in mosquito in amber (on which Crichton based his Jurassic Park) was refuted categorically by his peers in Science. In that case the lack of phylogenetic evidence  was the key. As long as Knight have the evidence like this, Nature Genetics would have granted the space for counter argument, which they didn’t, as helen said.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 07, 2004, 07:08:01 PM
To Helen_azar

I'm sorry, when I was referring to contamination and mentioned Prince Philip's blood being added to achieve perfect results I wasn't, obviously reffering to Nicholas or georgi. Their MtDNA stems from their mother Empress Marie and not Princess Alice..Prince Philip's line so your response to my post was lacking.

I have no argument concerning the DNA found from the 'so-called' remains of Tsar Nicholas 2nd EXCEPT to say that it is possible to say, keeping in character, that Nicholas's DNA was proported to be from Nicholas BUT was instead all from Georgi!

Hey!, If blood was added, a la Knight, then why are we to believe that only Alexandra's line was tampered with and not Nicholas's also.

I know these extrapolations are not totally substantiated until Dr. Knight reveals his 'paper', and /or Drs Gill and Ivanov can prove to all that what they did was correct. How? Well maybe another round of tests in front of impartial monitors would do the trick.

Best regards. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 07, 2004, 07:44:19 PM
JonC wrote: "To Helen_azar

I'm sorry, when I was referring to contamination and mentioned Prince Philip's blood being added to achieve perfect results I wasn't, obviously reffering to Nicholas or georgi. Their MtDNA stems from their mother Empress Marie and not Princess Alice..Prince Philip's line so your response to my post was lacking.
"


JonC, I think that once again you completely misunderstood what I was saying here. Of course I didn't think that you were referring to Nicholas's DNA when you said they probably added Philip's blood to it. I knew you were talking about the bones assumed to be Alexandra's and the daughters'. But this was not what I meant at all. The point I was trying to get across when I brought in Nicholas's results was that you need to look at the whole picture, all the evidence involved, and then decide if conspiracy was possible. Read my post more carefully and maybe you will see what I meant...

"I have no argument concerning the DNA found from the 'so-called' remains of Tsar Nicholas 2nd EXCEPT to say that it is possible to say, keeping in character, that Nicholas's DNA was proported to be from Nicholas BUT was instead all from Georgi!"

I already addressed the possibility that you would say this was the case, i.e. that there was also a conspiracy with Nicholas's bones, and I had replied to that before you even said it. Once again, if you re-read my post carefully, perhaps you will realize that what you are saying about Georgi's DNA makes no sense at all.  Georgi was exhumed several years after the tests on Nicholas's bones were performed, so how would it be possible that his DNA was subsituted for Nicholas's? He was interred at the time they did the tests and got the results! I am sure that you will now try to contend that Nicholas's DNA was substituted for Georgi's, but that wouldn't prove anything since his DNA sequence already matched the other maternal relatives,  some of it exactly, and the rest all but one base pair due to heteroplasmy. Do you understand what I mean?? Please read my other post again, everything I said there still stands...

"I know these extrapolations are not totally substantiated until Dr. Knight reveals his 'paper', and /or Drs Gill and Ivanov can prove to all that what they did was correct. How? Well maybe another round of tests in front of impartial monitors would do the trick.

Best regards. JonC."


JonC, I think it would be a waste of time and money to  redo these tests with "impartial monitors" like you suggest, because if the results turn out the same you will continue to have the same contentions. It's quite obvious that you understand neither the science nor the logic behind this, so this exchange between us has unfortunately become completely futile....
Quite frankly, I am very tired from trying to explain the same things over and over as best I can and getting absolutely nowhere, so we should just agree to disagree...

Best regards,

Helen


Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 08, 2004, 05:39:40 PM
To Helen.

Thanks Helen for painstakingly spelling it out for me. I appreciate your efforts to express your views to me. I must confess I had not read your previous post thoroughly, I'm sorry.

You were correct..you beat me to the 'georgi' argument.

The nuclear testing, from what I have read and discussed with others can identify a 'family group' that is true. The MtDNA testing identifies the actual lineages within that group and relative to that group. I still think that for this particular part of study ( the MtDNA) should be re-tested directly from the bones themselves with impartial monitors. Absolutely!

I want you to remember that the Nuclear results did not identify the skeletal remains as particularly 'Romanov'. I forget who mentioned it..maybe Radzinsky..that there was a family in that area who were also killed together and who resembled the imperial family. Their grave was never found.

I must admit, though, that the results presented on what is being touted as the tsar's remains are compelling.

My doubts are centered with the MtDNA testing of Alexandra and her daughters. i.e. the fresh blood being added etc.,by those responsible. I am waiting for Knight's paper also.

Best regards. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 10, 2004, 09:02:36 PM
Hello all
I am so sorry...What is all this about "fresh blood"?
I really don't understand what "fresh blood" JonC is talking about.... Who's blood?  What on earth has this to do with Alix's mDNA?
Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 10, 2004, 09:17:30 PM
Hello R darling :)

This "fresh blood" business.  Without going into obvious detail, I have heard this before.  ::)
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 10, 2004, 09:18:58 PM
Quote
What is all this about "fresh blood"?
I really don't understand what "fresh blood" JonC is talking about.... Who's blood?  What on earth has this to do with Alix's mDNA?
Rskkiya



Hi Rskkiya,

In order to support Alec Knight's contamination/conspiracy theory, JonC proposes that Prince Philip's blood was deliberately added to the tissue samples thought to be Alexandra's and the daughters'.  This, JonC contends, is why their mtDNA profile matched Philip's. Of course for this to be true,  both DNA profiles would have to come from the same sample (i.e. Philip's), and not just for the original sample to have been "contaminated" with his "fresh" blood.  No matter what logical evidence anyone proposes against this, JonC keeps repeating the same things over and over... as if that will make this case sound any different. So we are now mercilessly beating a dead horse... or perhaps a zebra, as JonC would have us believe... ;D
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 10, 2004, 10:58:31 PM
Jon C: I find your contention about the "salting" of the remains to be highly insulting to the many scientists who worked so hard on the identification of the Koptyaki remains. They really deserve better than this

Just why is it, I must ask, that you would rather believe there was some kind of conspiracy or mishandling of the remains? Do you have any idea how far-fetched this sounds?

Are you prepared to pay for all of this testing? Do you have any idea how expensive this would be?
Title: Re: New study questions identity of Romanov bones
Post by: Olga on October 11, 2004, 06:38:19 AM
JonC cannot accept the deaths of thee IF and has to keep making up wild conspiracy theories.
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 11, 2004, 08:58:45 AM
The "fresh blood" claim is that when Dr. Gill did the tests, the DNA was very degraded, just fragments, and he allegedly used "fresh DNA" to "fill in the sequences" to get a better result.

I am not scientific enough to read the papers in order to get the real answer, so perhaps someone who can understand the terms correctly might explain it in "plain English"...
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 11, 2004, 09:48:41 AM
Thanks to all for the clarification!
Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 11, 2004, 08:09:48 PM
Quote
The "fresh blood" claim is that when Dr. Gill did the tests, the DNA was very degraded, just fragments, and he allegedly used "fresh DNA" to "fill in the sequences" to get a better result.



Not exactly, FA. Yes, Dr Knight claims that because these samples are supposed to be from old bones the strands of ancient DNA should have been degraded, i.e. the long pieces broken up. The PCR product that Dr Gill got, i.e. the long mtDNA segments are "too good to be true" according to Knight, meaning too long to be accurate. (This is not exactly true, many DNA experts say that it is possible to get long strands, it just depends on the condition the DNA is in.)  JonC was initially implying that Prince Philip's blood was added to the original samples (contaminated) which caused the DNA sequence to match to his own. But, as I mentioned earlier, this is not possible because from a mixture of two different DNA's you cannot get a result that will exactly match one of them. The only way you could get an exact match here is if the original DNA was completely substituted by Philip's DNA, and then of course it would match to itself. So what JonC is currently saying is that he suspects that the DNA sequence obtained from the bone samples presumed to be Alexandra's and the daughters' is actually that of Philip's own, and this is why it matches to his exactly. In other words, the published DNA sequence really came from Philip's blood and not from the bones recovered from the Koptyaki grave , and because this blood was "fresh" the DNA strands were so long.

Helen
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 11, 2004, 09:59:44 PM
If this is the case, it seems likely that JonC is either Rodger or being coached what to post by Rodger. He has been known to do this before!

That's why Rodger was so upset when he found out that an American laboratory had sequenced the Victorian mtDNA long before Prince Philip was asked to help with the identification of Alexandra and her daughters. It completely upset the theory he had been able to convince Dr. Knight about.

Since Dr. Knight has not availed himself of the opportunity we gave him to straighten all of this out, I have to guess that he was duped by Rodger/Litwin, otherwise, it would be very easy to clear this up.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 11, 2004, 10:19:54 PM
To Lisa.

There you go on that witch hunt again. I would like to remind you that the 'fresh blood' idea was not presented to the universe by me. I am only reminding everyone that Dr. Knight's rebuttal, which has not been refuted by anyone yet, is that Dr. Gill used fresh blood to get his 'perfect' results. This fact is IMPORTANT..don't you think? And, why do you care about the cost of additional research? Unless you are paying for it..are you? I don't think so! Your objection to more research is ridiculous!

I would like to get all the facts. Facts which cannot be refuted by anyone. MtDNA facts/results which are above reproach so that I can believe that the Royal Family has truly been found, without question.

Why is this such a problem to you? Please, I don't know Rodger, I am not Rodger, SO? What IS insulting is that just because I have a different opinion from you on this matter that you should attack me so. I just don't understand you!

Lastly, you should understand that whatever it is that you think Rodger/Litwin confused Dr. Knight about has no importance to me. What IS important, which Rodger/Litwin has nothing to do with is of Dr. Knight's revelation to the scientific community that fresh blood was added to Dr. Gill's sample for him to abtain perfect MtDNA results from old bones lying in a shallow muddy warm grave for 80 years...an impossible task!

Therefor are the bones then the missing Royal Family's. I don't believe so...Sorry! JonC.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 11, 2004, 10:26:26 PM
This issue, of the purported Romanov remains belonging to somebody -- *anybody*-- else really is important to you, isn't it?

The type of *facts* you are demanding are probably not possible to obtain in this case, and in the field of science, such "in cement", "case closed" phrases are not normally used.

"Rodger" was/is a screen name, a pseudonym, if you will, so of course you're not "Rodger"! ;)
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 11, 2004, 10:37:02 PM
Dashkova.

Dream on dear.
Title: TRe: New study questions identity of Romanov bones
Post by: LisaDavidson on October 12, 2004, 12:54:21 AM
Jon C: I reject your claim that you are interested in the facts. If anyone reviews your postings, they will quickly see that you are only interesting in repeating Rodger/Litwin's drivel. To wit:

"There you go on that witch hunt again. I would like to remind you that the 'fresh blood' idea was not presented to the universe by me. I am only reminding everyone that Dr. Knight's rebuttal, which has not been refuted by anyone yet, is that Dr. Gill used fresh blood to get his 'perfect' results. This fact is IMPORTANT..don't you think? And, why do you care about the cost of additional research? Unless you are paying for it..are you? I don't think so! Your objection to more research is ridiculous!"

1. I am not on a witch hunt. I am interested in finding out where the missing remains are, as anyone could tell you.
2. Dr. Knight's rebuttal is not scientifically valid according to the scientists I've talked to. He has made some very serious accusations against Dr. Gill, which he has not backed up with anything factual. The reason why no one has "refuted" it, is that Dr. Knight has not had the courtesy to tell us how a claimant found his way on to his scientific team. If it's a question of who appears biased, Jon, Dr. Knight's group appears to be highly biased and the only person I've met who doesn't feel this way is: Rodger/Litwin! oh, and You!  Imagine that!  
3. I think it's highly important that Dr. Knight explain himself - don't you? I cannot consider anything he or his team has written until he explains himself.  He hasn't.
4. For the record, as a US taxpayer, I've already paid a good amount of money to test the Romanov remains. Governments pay for the majority of this testing, and yes, as the person who's paying the bills, I do care if crackpots like the Stanford group waste my hard earned money, or try to. So, my objection to "research" is certainly not ridiculous - it's a valid point.
5. Dr. Gill's team contained no claimants clamoring for different results.

Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 12, 2004, 01:04:08 AM
I would like to get all the facts. Facts which cannot be refuted by anyone. MtDNA facts/results which are above reproach so that I can believe that the Royal Family has truly been found, without question.  

Why is this such a problem to you? Please, I don't know Rodger, I am not Rodger, SO? What IS insulting is that just because I have a different opinion from you on this matter that you should attack me so. I just don't understand you!  

************************************
Other than Rodger's theory, you have not presented any evidence that makes me think the exisiting identification of Gill, et all, is not above reproach or that the family has not been found. You have not explained why you think their findings are invalid except that you buy that Gill is so unethical that he would salt what some people regard as sacred remains.

I have no desire to insult you, Jon, but you keep parroting Rodger/Litwin, so what are we to think? A different opinion than mine is fine, but back it up with something other than what he's said, because he clearly has an agenda, and has a bias. You have said nothing here that explains why you don't have an agenda or bias. If you didn't you could at least consider that the work of identification is done.

Why is this a problem with me? Well, Jon, a dear friend of mine sacrificed his life to ensure his cousin, the last tsar, got a Christian burial. This may be meaningless to you, Jon, but when you attack the scientific work in which he participated and say without foundation (except to trash a scientist) that you are not satisfied with the results, I have to wonder, what right do YOU have to do this? to say this? This man died before his time and that's not enough for you? Frankly, it disgusts me.



Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 12, 2004, 08:16:28 AM
Quote


What IS important, which Rodger/Litwin has nothing to do with is of Dr. Knight's revelation to the scientific community that fresh blood was added to Dr. Gill's sample for him to abtain perfect MtDNA results from old bones lying in a shallow muddy warm grave for 80 it years...an impossible task! [/i]quote]

JonC,

Of course you are entitled to believe what you choose, that makes absolutely no difference when it comes to facts. The reality is: Dr Knight's "revelations" are  misleading, and people who don't fully understand the science part of this (much like yourself) are accepting them as fact. It is not "an impossible task" to get these results, and quite a few experts will tell you so. Much of Dr Knight's contentions are very questionable because of his own methods: he himself has made some very serious mistakes (whether deliberately or purely by neglect is unclear, and irrelevant). And his mistakes are much more serious than the ones he pointed out in Gill's work, not the least of these is the fact that he used unknown DNA source (finger) as his control - a very serious breech of scientific protocol. Based on that, any claims he makes in his paper have been more or less negated. Because of the reasons I just mentioned, his paper got rejected by peer reviewers of a prestigious scientific journal, the same one, if I may add, that accepted Gill's work... while Knight's paper finally got published in a journal much more inferior.  Based on this alone, I can confidently say that not all is well with Knight's paper.

Helen
Title: Re: TRe: New study questions identity of Romanov b
Post by: Helen_Azar on October 12, 2004, 08:25:48 AM
Quote
Jon C: I do care if crackpots like the Stanford group waste my hard earned money, or try to. So, my objection to "research" is certainly not ridiculous - it's a valid point.
 


Lisa, to be fair, the Stanford research was paid for by a private grant, I forget the name of the group now, but I believe it was somehow connected to the orthodox church (?). This of course opens up another can of worms altogether, but we won't go there...  ;)
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 12, 2004, 11:57:08 AM
Helen:

You are, of course, correct. My objection is that JonC is advocating re-testing (likely at government expense) on the basis of a paper and testing that, as you point out, failed to be published in a top scientific journal. Thank you for providing the missing piece of my argument.

Jon C:

I must also regretfully reject the notion that the Rodger/Litwin connection with the Knight paper has nothing to do with the shameful assertion that Gill salted the Koptyaki remains. It goes to the very heart of the matter - it goes to why the paper was done in the first place.

Had Litwin's mtDNA matched the Koptyaki remains, I am absolutely certain that the Knight paper would have never been done. All of this was done for one reason only - to satisfy an unsuccessful claimant. I have  experience working with Romanov claimants, Jon.

I've been working with them for years. One thing I insist on is, if the testing is negative, the matter is dropped. It is hard for some of them to drop it at that point, because they want so badly, sometimes desperately, to be related to the IF.

Is that the case for you? I am really trying to understand why, if you are not Litwin or being coached by him, why you are clinging to such bad science and such slurs against fine scientists.
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on October 12, 2004, 12:15:43 PM
Rather than get involved as to the actual justification of all this "new" research, I am curious as to who is actually paying for it?  The governments concerned seem to be satisfied with the previous results, as do the families and both ROCs. At least I have read of no dissention from them.
Stanford ? Why ? They do have the Hoover Inst. with a lot of Romanov papers, but would that really make them so interested? They have a reputation to protect and are not prone to risking it on such dubious merits.
The prof. involved ? Someone has to pay for all the lab work, time, travel, salaries, materials. I do not know of any that make THAT much money.
Grants ? From whom and why?
Claimants themselves ? They would need some pretty hefty resources of their own and/or financially comfortable supporters.
And finally, to what end?
At the end of the day, what benefit to history, science, family pride [?], political gain or even religous belief ?
We are all aware that there is no financial gain to be had. No throne to recover. Any other suggestions I am unaware of?
Cheers,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 12, 2004, 12:42:41 PM
We do not know "who" is/has funded Dr. Knight's most recent paper, he would not answer that question until after it is published.

We believe, from his statements, that Stanford is NOT involved, and we know the Hoover Int. is NOT involved.

The conversations with Dr. Knight seem to indicate that his historical research is not as "comprehensive" as his scientific research. For example, he was unaware of the most recent and accurate publications on the subject, as was he unaware of some important sources.

But as we have said, we must just "wait and see" until/if the paper is published.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 12, 2004, 03:30:03 PM
Quote
 The governments concerned seem to be satisfied with the previous results, as do the families and both ROCs. Robert


Robert,
I may be wrong about this, but I was under the impression that the Russian orthodox church has not accepted the results that showed that the Koptyaki bones belong to the IF...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 12, 2004, 03:49:36 PM
Quote
...slurs against fine scientists.


In his paper, Dr Knight never actually says that anyone deliberately added fresh blood to the Koptyaki samples, this was JonC's own embellishment. I am not so sure that JonC even read this Knight paper: he has been making statements that lead one to believe that he hasn't, or if he has, he did not fully understand it.
The closest Knight comes to what JonC is saying, is when he states that Gill's results are consistent with fresh DNA, not ancient one, and suggests contamination. But Knight never explains how all four sequences ended up matching control DNA (Philip's)after contamination. So the implications of conspiracy are definitely there if you read between the lines. These are extremely serious allegations against a respected scientist, considering there is no actual proof of foul play. I am very surprised that Dr Gill is not doing anything to counteract these allegations, or maybe he is, does anyone know?

H
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 12, 2004, 04:02:16 PM
Robert wrote:Rather than get involved as to the actual justification of all this "new" research, I am curious as to who is actually paying for it?  The governments concerned seem to be satisfied with the previous results, as do the families and both ROCs. At least I have read of no dissention from them.


Stanford ? Why ? They do have the Hoover Inst. with a lot of Romanov papers, but would that really make them so interested?

Here are my opinions, based on info I had access to at the time the original paper was being written. Regarding Stanford.  Litwin was attending law school in Sacramento at the time, with Stanford not being a terribly long drive from there.  He went to the Hoover Institue with his collection of photographs and his "imperial prayerbook"  ::) and supposedly talked with the curator.  He claimed that this individual was so amazed with the "prayer book" that he nearly had a heart attack.  Apparently through someone Litwin met at Hoover or Stanford, he was put in touch with Alec Knight.  If you could see the "prayerbook" you would really wonder about the curator, in fact, wonder if the whole "visit" was a lie.  Litwin claimed he took his father with him for this meeting at the Hoover


They have a reputation to protect and are not prone to risking it on such dubious merits.
The prof. involved ? Someone has to pay for all the lab work, time, travel, salaries, materials. I do not know of any that make THAT much money.

Well, that's right.  There are plenty of comfortably well-off professors, plenty more who aren't, and very few who are millionaires.  At the time I knew Litwin and was in communication with Knight, the latter was living in a very small mobile home.  I know this because Litwin, once he was evicted from his apartment in Sacramento, went to stay with Knight in Palo Alto area, but due to lack of space (and the fact Litwin was apparently not seeking employment)he was asked to leave after about a week

Grants ? From whom and why?
Claimants themselves ? They would need some pretty hefty resources of their own and/or financially comfortable supporters.

Hah, definitely no money on the part of the claimant. Litwin is a "sponger".  Did I mention that collection agencies and "advance payday" companies still call my phone number looking for him?  Two years later?  No money in the family, either, though he does have apparently a wealthy acquaintance in New York who has a psychology practice (and a website for same).

And finally, to what end?
Because Tsar Daryl demands his throne! And it seems Knight is in agreement. Ditto Zhivotovsky.  I wonder if anyone has tried to contact Lev about this?

At the end of the day, what benefit to history, science, family pride [?], political gain or even religous belief ?
We are all aware that there is no financial gain to be had. No throne to recover. Any other suggestions I am unaware of?

Litwin thinks there is a big pot of gold at the end of his tsarist rainbow.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 12, 2004, 04:06:35 PM
Quote
We do not know "who" is/has funded Dr. Knight's most recent paper, he would not answer that question until after it is published.

We believe, from his statements, that Stanford is NOT involved, and we know the Hoover Int. is NOT involved.

The conversations with Dr. Knight seem to indicate that his historical research is not as "comprehensive" as his scientific research. For example, he was unaware of the most recent and accurate publications on the subject, as was he unaware of some important sources.

But as we have said, we must just "wait and see" until/if the paper is published.



I am wondering about something.  True, if funding for this project came from somewhere other than Stanford/Hoover, then their stamp of approval isn't necessarily on it, but what can one say when more than one of the scientists listed on the article *are* associated with Stanford?  It still looks bad for the university, since one of the first things I think anyone looks at when reading a scholarly journal article, is *where* the authors are employed.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 12, 2004, 04:16:09 PM
Quote
Ditto Zhivotovsky.  I wonder if anyone has tried to contact Lev about this?[/color]



Dashkova, early on, I thought about writing to Zhivotovsky, since I also read his paper. But to be honest, I feel like I am sort of running out of steam, plus I am reasonably sure that we won't get a straight answer out of him either, he will probably give us the same old "wait for the new paper" line...  :-/
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 12, 2004, 04:21:07 PM

Doesn't Zhivotovsky work for the Russian Expert Commission Abroad? Someone mentioned that before, I think. So maybe this is who is paying for this new paper? Whoever it is, I am pretty sure it is a private grant....
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 12, 2004, 05:38:58 PM
Lisa.

It doesn't matter why the study by Dr. Knight was made what matters is that it was done, and it puts a damper on Dr Gill's work.

I mention that 'fresh blood ' was added to the sample worked on by Dr. Gill not because I made it up but because that is the inferrence by Dr. Knight. When I spoke to him months ago he did say that the contamination was 'fresh blood' from a relative but he didn't know who. I'm thinking that if he is right then it must be from Prince Phillip - MY opinion only!Thus the results created have to match Prince Phillip's MtDNA.

I hold my views because they are justified, and in sequence to the available present facts!

I also hold my views because the Russian Orthodox Church has cast its view that the Koptiaki forest remains are not of the Tsar's family.

Now for the last time...I AM NOT LITWIN/RODGER OR ANYONE CONNECTED TO HIM/THEM. Thank you! JonC.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 12, 2004, 06:35:02 PM
 
Quote
...Dr. Knight.... When I spoke to him months ago he did say that the contamination was 'fresh blood' from a relative but he didn't know who.
 JonC.


JonC,

First I want to say that personally I don't really care if you are Litwin or Rodger, or even Elvis... I was just curious, how many times HAVE you talked to Alec Knight? The last we heard, you called him on September 23 (I just checked on this thread), but then you just said you spoke to him months ago?? So have you talked to him before September 23? I know time flies when you're having fun, but today is only October 12th and it certainly hasn't been months. So was it a... Freudian slip? Come on, JonC, 'fess up...  ;)

Thank you!
Helen   :D
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 12, 2004, 11:23:47 PM
Helen, time does fly and it does seem like months since I spoke to him.

When in September I said I spoke to him didn't mean that I spoke to him IN September. I don't remember exactly when I did speak to him it could have been in July or August.

We have since written e-mails to each other if that's anything of value to you. Now why do you find it necessary to ask me to 'fess up'? What do you think I should 'fess up' to now? I take it that you don't believe I spoke to him, right? If so...wow! I tell you, you and Lisa can shake hands. Pray tell me how on Earth does Freud fit in here or is that just loose talk with no rhyme or reason? JonC.
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on October 13, 2004, 02:33:00 AM
 Helen,to be quite honest, I do not know any longer what the positions of the ROCs are.  At the time of the burial rites in St.Petersburg, the ROC would neither confirm nor deny the remains. I understand this is still their position, with a leaning toward recognition. After all, they are beatified now, so confirmation is far more likely.
I THINK the ROCOR had already verified them, of their own volition.
I am quite willing to bow to anyone who knows better in this.
Cheers,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 13, 2004, 08:18:40 AM
Quote
Helen, time does fly and it does seem like months since I spoke to him.

When in September I said I spoke to him didn't mean that I spoke to him IN September. I don't remember exactly when I did speak to him it could have been in July or August.

We have since written e-mails to each other if that's anything of value to you. Now why do you find it necessary to ask me to 'fess up'? What do you think I should 'fess up' to now? I take it that you don't believe I spoke to him, right? If so...wow! I tell you, you and Lisa can shake hands. Pray tell me how on Earth does Freud fit in here or is that just loose talk with no rhyme or reason? JonC.


My-my, JonC, where is your sense of humor? Such unneccesary hostility  :o  :P, and well... it appears "the lady doest protest too much"...  You take yourself much too seriously, JonC. Well, I guess someone has to...  Oops... sorry, I usually don't do "digs", but couldn't resist that one... JonC, my friend, you just seem to bring out the worst in me and I don't like it, and this is why we must part "cyber company", so to speak  ;D  :-X. Hey, give me a break, I tried to settle this with you before in a civil and friendly manner by agreeing to disagree and leaving it at that, but you just wouldn't let me, would you, so what's a girl to do? ::) Ok, from now on, I promise, I will not let you bait me and cause me to waste my breath, or rather my poor typing fingers, on various logical explanations that you either ignore or more likely just don't have the ability to comprehend   ??? :P  

So long JonC, or whoever you may be... (oops, again!!  ;D)

Au contraire, I do believe you speak to Alec Knight, maybe a little too much.... So I want to give you just one more sound piece of advice as a gesture of goodwill, I am happy for you and Alec Knight and all, but you can trust me on this one: you shouldn't discuss your interactions with him (before or after September) on this board anymore, because you just keep digging yourself deeper with that one!

Good luck in your future endevors  ;)...

H
Title: Re: New study questions identity of Romanov bones
Post by: Michelle on October 13, 2004, 08:24:13 AM
Guys, guys, come on now! >:( Helen, JonC is of course going to respond to you (especially that last comment) because you're harping on him for some reason you think (and others) that he's Litwin!  It's only natural that he's going to defend himself! I would too if I was getting crucified as much as he is (and as I have in the past>:()!  This is getting a little out of hand.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 13, 2004, 08:34:52 AM
Quote
Guys, guys, come on now! >:( Helen, JonC is of course going to respond to you (especially that last comment) because you're harping on him for some reason you think (and others) that he's Litwin!  It's only natural that he's going to defend himself! I would too if I was getting crucified as much as he is (and as I have in the past>:()!  This is getting a little out of hand.


Thanks Michelle - I have no doubt that JonC will respond, but not to worry, as I already said, I will be overlooking his comments from now on...

*BTW, I never said I thought JonC was Litwin, I just said I didn't really care if he was  ;) .

Michelle, I think you are being a trifle melodramatic here when you say JonC is being crucified... This is called "disagreeing" with someone and discussing why you are disagreeing with them, it is not "crucifying" them. And depending on how that someone responds, you either continue disagreeing with them or you make light of it, whichever you fancy most. I myself have been in a position when everyone else disagreed with me and argued with me, on this very thread as a matter of fact, so this kind of thing happens all the time.
In any case, my recent post to JonC (the one before last) was "tongue-in-cheek", an attempt to lighten up the situation a bit for him. But he and I seem to have an ongoing communication gap. This is why I asked him about his "sense of humor": he read my post - misconstrued it as usual - and proceeded to jump down my throat. And this is why I just couldn't help myself after that. So I guess my original attempt at goodwill went over some people's heads... especially his own. Oh well...  ::)
Let's get back to the subject at hand.

Helen
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 13, 2004, 06:53:58 PM
Hi JonC,
I am very curious about what you said (below) regarding the bone "contamination", if it's true. How did you know (or infer) that Dr. Gill added fresh blood? I checked the paper, but Dr. Knight never mention it. My impression is that Dr. Knight suspects that Dr.Gill was duped by Russian people who were involved. But if your hoax theory is true, i have to re-examine this case completely. As you actually talked to Dr. Knight in person, you might know what I don't know. I would appreciate if you could enlighten me in this regard. Thanks.
Dave



<you wrote>-----------------------------------------------------
you and others believe then why hasn't someone done it. DNA, as Dr. Knight has shown con be manipulated based on the researcher's honesty/interest in the outcome of the results i.e.  Dr. Gill supposedlly adding 'fresh blood' in his team's results and Dr. Knight's hidden pretender. What do you think?  

Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 14, 2004, 06:06:02 PM
DaveK.

I sent you a note. I thought it best to explain that way. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 14, 2004, 06:11:46 PM
Helen_azar.

Helen, I wish I could transcend the ether we communicate through and hold your hand and look into your eyes and tell you that I hold your opinion in high esteme.

I have no ill feelings toward you and hope you don't of me. I am sorry if I have offended you in any way and hope to learn from your future posts. We do differ but that's ok. Best regards. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 14, 2004, 06:15:24 PM
Quote
Helen_azar.

Helen, I wish I could transcend the ether we communicate through and hold your hand and look into your eyes and tell you that I hold your opinion in high esteme.

I have no ill feelings toward you and hope you don't of me. I am sorry if I have offended you in any way and hope to learn from your future posts. We do differ but that's ok. Best regards. JonC.


Ewwww  :P  
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 14, 2004, 06:16:19 PM
Quote
DaveK.

I sent you a note. I thought it best to explain that way. JonC.


;)
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 14, 2004, 07:04:44 PM
Just as a progress report to anyone watching this site, JonC doesn't know any thing new that indicates Dr. Gill committed deception. JonC acknowledged that he was also suspecting that Dr. Gill could have been simply duped.  

And as a note: Dr. Knight himself said that
http://dsc.discovery.com/news/afp/20040712/tsar.html

Knight said he was not impugning Gill, "but rather the actions of those in Russia who had control of all the samples, concluded at the outset that they were the royal family, acted with secrecy and deception, distributed the samples to the labs in other countries, participated in the analysis, wrote a report concluding identity and then voted on acceptance of that report."
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 14, 2004, 07:25:58 PM
Davek-- thanks for the clarification...

JonC---Whats the big secret? Just post the facts.

Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 14, 2004, 07:40:45 PM
Dave.

Yes I had suspected that the Russian authorities had a hand in the 'deception' as you say.

I also thought the Brits had something to do with the deception because at that specific time of the discovery of the bones Russia's Yeltsin was in a fight for democracy and the British Government made it known that it would actively help preserve Russia's transition. Did this mean they would help falsify the study on the bones? I don't know.

What made me skeptical of Dr. Gill...to this day...is how his team didn't question the samples provided to them. Simply accepted the samples from the Russians without questioning the handling of the samples or complaining that the samples may have been contaminated due to the lack of security at the discovered grave site.

All the scientists from Dr. Maples to Dr. Gill and the rest of the team seemed to have skipped all of these necessary safeguards and accepted the samples from the Russians as official Romanov samples without question. No self respecting scientist would have accepted all that nonsense unless there were ulterior motives/ orders by the British Gov.

I am not going to judge Dr. Gill and his team although I think better judgement should have been used by them. Best regards. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 14, 2004, 07:47:56 PM
All the scientists from Dr. Maples to Dr. Gill and the rest of the team seemed to have skipped all of these necessary safeguards and accepted the samples from the Russians as official Romanov samples without question. No self respecting scientist would have accepted all that nonsense unless there was an ulterior motive. Best regards. JonC.[/quote]


Sheesh...then what does that say about Knight and company?  Some finger with no provenance. Not very self-respecting!
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 14, 2004, 08:28:16 PM
JonC, thanks for your reply.

I still think that even if the hoax existed, Dr. Gill must have been simply duped. My rationale: it was well known since late 80's that old degraded DNA doesn't produce long PCR product. Had Dr. Gill participated in the scheme as a scientific advisor, he would have produced the short PCR product, so that it looked like real degraded old DNA. What's the point of showing long PCR product, which simply raise suspicion? Do you agree?

As to why Gill didn’t suspect things. Because it’s not his job. Did you ever watch CSI show? (it's a good show, I learn a lot.) Dr. Gill’s job was just like a geeky technical boy who does only analysis. Gill’s coauthors, who were historical experts, are the people who must have been watching these things. Nature's reviewers and editors were also responsible if there were any hoax, but still, it's not Gill's fault.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 14, 2004, 08:38:49 PM
Quote
All the scientists from Dr. Maples to Dr. Gill and the rest of the team seemed to have skipped all of these necessary safeguards and accepted the samples from the Russians as official Romanov samples without question. No self respecting scientist would have accepted all that nonsense unless there was an ulterior motive. Best regards. JonC.Sheesh...then what does that say about Knight and company?  Some finger with no provenance. Not very self-respecting!

Yes, this is definitely a case of "the pot calling the kettle black" ;)
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 14, 2004, 08:55:17 PM
Quote
JonC, thanks for your reply.

I still think that even if the hoax existed, Dr. Gill must have been simply duped. My rationale: it was well known since late 80's that old degraded DNA doesn't produce long PCR product. Had Dr. Gill participated in the scheme as a scientific advisor, he would have produced the short PCR product, so that it looked like real degraded old DNA. What's the point of showing long PCR product, which simply raise suspicion? Do you agree?

As to why Gill didn’t suspect things. Because it’s not his job. Did you ever watch CSI show? (it's a good show, I learn a lot.) Dr. Gill’s job was just like a geeky technical boy who does only analysis. Gill’s coauthors, who were historical experts, are the people who must have been watching these things. Nature's reviewers and editors were also responsible if there were any hoax, but still, it's not Gill's fault.


But Dave, do you think that Gill would have looked at some completely incongruous results and not suspect anything? Don't you think a little lightbulb would go off in his head and he would think, "something is not right here" let me find out what's going on? If it were me and that happened, I would at that point be questioning the origin of this sample before putting my name to this work... Theoretically you are right, a technician's job is to come up with a sequence from a sample provided to him, except Dr Gill is not just a technician, he is a scientist and there is a difference. A technician performs the technique and comes up with results, and then his job is done, a scientist will do the same, but he will also evaluate and question his results if something is not consistent. So in my opinion, if any foul play was involved, Gill would have to be in on it. And of course the peer reviewers at Nature Genetics would have definitely caught on and questioned these results if they were as impossible as Dr Knight claims.  Fact is, the reviewers didn't question these results and this paper was published in Nature Genetics, one of the most prestigous scientific journals in the world. And another fact is, NG reviewers had all kinds of questions about Knight's work (rightly so) and rejected his paper. So a more likely scenario is that Dr Gill's results are not as impossible as Dr Knight wants us to believe. They may be unusual, but not impossible. If someone has been able to do this in the past, i.e. come up with a longer than usual sequence of ancient mtDNA, then it is plausible someone else could repeat it...

Helen  :)
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 14, 2004, 09:14:19 PM
Helen; I agree! And because there is doubt in the air concerning Dr. Gill's results even though as you say they might be 'plausible', I for one would like to see the study done again but from a fresh, clean sample minus any contamination directly from the bones. I would like to see the work supervised by impartial, independent observers. Cost should not be a factor.
Best regards. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on October 14, 2004, 09:58:12 PM
Cost certainly IS a factor, unless you are paying for it !
Cheers, then,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 14, 2004, 11:43:51 PM
"Cost should not be a factor"??

A chronic "sponging" ne'er do well would make such a comment, but that would be someone like Litwin, not JonC.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 15, 2004, 08:46:51 AM

Speaking of cost, if someone wants to fund something like this privately - more power to them - they are perfectly entitled. But I just took another quick look at the Knight paper, and contrary to what I initially thought, evidently this research was partially funded by the NIH! This is the money that should more justifiably have gone towards much more needed cancer or AIDS, or any number of diseases, research... That is the real shame about all of this :(  >:(

Helen
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 15, 2004, 11:49:08 AM
Quote
Dave.

Yes I had suspected that the Russian authorities had a hand in the 'deception' as you say.

I also thought the Brits had something to do with the deception because at that specific time of the discovery of the bones Russia's Yeltsin was in a fight for democracy and the British Government made it known that it would actively help preserve Russia's transition. Did this mean they would help falsify the study on the bones? I don't know.

What made me skeptical of Dr. Gill...to this day...is how his team didn't question the samples provided to them. Simply accepted the samples from the Russians without questioning the handling of the samples or complaining that the samples may have been contaminated due to the lack of security at the discovered grave site.

All the scientists from Dr. Maples to Dr. Gill and the rest of the team seemed to have skipped all of these necessary safeguards and accepted the samples from the Russians as official Romanov samples without question. No self respecting scientist would have accepted all that nonsense unless there were ulterior motives/ orders by the British Gov.

I am not going to judge Dr. Gill and his team although I think better judgement should have been used by them. Best regards. JonC.


Ohh Gaaawwwd...
Not more paranoid conspiricy theories?[/i]Please! What sort of a cloak and dagger fantasy is all this?
Are we to expect more KGB operatives wandering about the clinics and the morgue next?
I would laugh if I weren't so disappointed!
Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 15, 2004, 12:01:18 PM
KGB Operatives?

Oh yeah! They're everywhere! And don't forget the Illuminati! (psst: its been *said* I am among the "sleeper operatives" of the latter, while my husband is with the KGB)

The "Litwin Brigade" seems to be in full force on this thread.

Did I say "brigade"?  That should read: army of one.
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on October 15, 2004, 12:36:11 PM
Helen, I shall ask you directly, as I think you are the only one of us actually involved in this sort of employ.
Just what cost does this sort of project entail?
Best,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 15, 2004, 02:07:27 PM
Wait a minute.
I just recognized that there was no way that the bone was covered with fresh blood of Prince Philip.  
Dr. Gill did two tests.
1)      mtDNA matched with Prince philip’s mtDNA.
2)      Nuclear DNA’s karyotype was XX (female) , not XY (male).

If it’s Prince Philip’s fresh blood, it should show a XY (male) type.
What do you think JonC?  
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 15, 2004, 02:15:51 PM
Quote
Helen, I shall ask you directly, as I think you are the only one of us actually involved in this sort of employ.
Just what cost does this sort of project entail?
Best,
Robert


Robert, of course I can't give you specific figures, but I know that this kind of research is not cheap, and can get extremely time consuming.  Some of the enzymes alone can be very expensive...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 15, 2004, 02:25:11 PM
Quote
Wait a minute.
I just recognized that there was no way that the bone was covered with fresh blood of Prince Philip.  
Dr. Gill did two tests.
1)      mtDNA matched with Prince philip’s mtDNA.
2)      Nuclear DNA’s karyotype was XX (female) , not XY (male).

If it’s Prince Philip’s fresh blood, it should show a XY (male) type.
What do you think JonC?  


DaveK, that is a very good point! Are you a scientist? Of course what will happen now is that it will be claimed that the DNA substitution must have come from a sample from a female relative... So there is no logical argument you can make that will convince those who don't want to accept that this hoax is impossible... Believe me, I tried  :-/

H
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 15, 2004, 02:27:28 PM
P.S. this XY-XX can also be determined by PCR, not by microscope. I am 100% sure about this, because I saw it on the CSI show.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 15, 2004, 02:43:19 PM
Quote
P.S. this XY-XX can also be determined by PCR, not by microscope. I am 100% sure about this, because I saw it on the CSI show.


Um, I'm sorry, but are you saying you believe something because you saw it on tv? Isn't CSI a fictional drama?  For the masses as opposed to scientists?
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 15, 2004, 02:48:57 PM
Quote

Um, I'm sorry, but are you saying you believe something because you saw it on tv? Isn't CSI a fictional drama?  For the masses as opposed to scientists?

I believe what Dave is saying about karyotype is accurate even though he did get it from CSI  ;)
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 15, 2004, 03:04:55 PM
Oh, I realize that!  I just was surprised anyone would say that they knew something was so because they had seen it on a television drama.  :-/
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 15, 2004, 04:46:08 PM
Quote
"Cost should not be a factor"??

A chronic "sponging" ne'er do well would make such a comment, but that would be someone like Litwin, not JonC.



Dashkova, my dear abrasive woman. I feel so ashamed for you when I read your posts that I wonder if there is anything I could do for you to help you.

Your Communist upbringing/ tendencies have apparently left you devoid of any sensitivity of the necessity for brotherly love. I feel sad for you and I will pray for you. JonC.
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 15, 2004, 05:45:42 PM
That’s ad hominem attack. Truth is truth, no matter where it came from. Don’t trust/distrust anything just because it came from authentic/dubious journal, that’s why I respect JonC’s incessant Crusade against a prestigious study from leading scientists in an authentic scientific journal. “National Enquirer” and “Globe” has often more truth than New York Times which published articles by Jason Blair.  
Besides, Jerry Bruckheimer was telling that all science in the drama is true because they have scientific advisory board which includes many real scientists.



Quote

Um, I'm sorry, but are you saying you believe something because you saw it on tv? Isn't CSI a fictional drama?  For the masses as opposed to scientists?

Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 15, 2004, 06:07:41 PM
Davek...a man of character, finally!

With respect to your discovery that the Nuclear DNA test was performed on a sample coming from a  female(xx) - I will have to familiarize myself with that section of the research which dealt with the Nuclear testing. I have an original 'Nature Genetics' article on the Romanov remains.
I know that Nuclear DNA can isolate family groups within an environment. As opposed to MtDNA which deals with ancient DNA handed down from the female line. I will get back to you. Best regards. JonC.

Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 15, 2004, 07:15:36 PM
JonC,
Take your time.  
To make the hoax theory alive, only possibility is that they used fresh blood from some female, but not from Prince Philip.
But here is some more challenges: there are FOUR different nuclear DNAs "XX type" evidences and all four mtDNAs are same as Prince Philip. If they had used fresh blood, you have to fulfill four condition:
1)  they had to collect four different blood.
2) this four person's relationship must be thee daughters and one mother. All living.
3)  all 4 have to be maternal relative of Tzarina.
4) father of daughters have to be maternal living relative of Tzar.

Do you think of any 4 females in British royal family who fulfills this conditon? Does Prince philip have three daughters by any chance? Is it possible that Prince Philip's wife got all three daughters from affair with grandson of Louise of Hesse-Cassel who was Tzar's maternal relative?  

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 15, 2004, 08:56:24 PM
Quote
JonC,
Take your time.  
To make the hoax theory alive, only possibility is that they used fresh blood from some female, but not from Prince Philip.
But here is some more challenges: there are FOUR different nuclear DNAs "XX type" evidences and all four mtDNAs are same as Prince Philip. If they had used fresh blood, you have to fulfill four condition:
1)  they had to collect four different blood.
2) this four person's relationship must be thee daughters and one mother. All living.
3)  all 4 have to be maternal relative of Tzarina.
4) father of daughters have to be maternal living relative of Tzar.

Do you think of any 4 females in British royal family who fulfills this conditon? Does Prince philip have three daughters by any chance? Is it possible that Prince Philip's wife got all three daughters from affair with grandson of Louise of Hesse-Cassel who was Tzar's maternal relative?  



DaveK, I had to chuckle a little at your last statement, as Philip's wife happens to be Queen Elizabeth II of England, and it just striked me as kind of funny about the possibility of her having three illegitimate daughters with the grandson of  Louise of Hesse-Cassel ;D. By the way, as far as we know, Philip has only one daughter: Princess Anne...  But, these are all excellent points you make, and this conspiracy would have to have been even more involved than I thought! DaveK, I don't care if you read the National Inquirer for fun and profit, you are brilliant nevertheless!  ;)
Helen
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 15, 2004, 11:52:33 PM
Quote


Dashkova, my dear abrasive woman. I feel so ashamed for you when I read your posts that I wonder if there is anything I could do for you to help you.

Your Communist upbringing/ tendencies have apparently left you devoid of any sensitivity of the necessity for brotherly love. I feel sad for you and I will pray for you. JonC.


"JonC", you are a pathetic and particularly transparent creature.  My advice to you is that you not communicate with me again.
Oh, and as for help, I don't need any. But please, PLEASE direct your help to yourself, where it is very much needed.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 15, 2004, 11:54:28 PM
Quote
That’s ad hominem attack. Truth is truth, no matter where it came from. Don’t trust/distrust anything just because it came from authentic/dubious journal, that’s why I respect JonC’s incessant Crusade against a prestigious study from leading scientists in an authentic scientific journal. “National Enquirer” and “Globe” has often more truth than New York Times which published articles by Jason Blair.  
Besides, Jerry Bruckheimer was telling that all science in the drama is true because they have scientific advisory board which includes many real scientists.





Well, now, just what else would you expect him to say?  ::)
Title: Re: New study questions identity of Romanov bones
Post by: Candice on October 16, 2004, 05:23:54 PM
DaveK, and JonC I'm amazed at the points you have both raised.  What you have pointed out is something to reflect upon.  What a conspiracy!

I didn't know about sister Pascalina Lehnert. Could it be that the Orthodox church and the Catholic church were both working together to save the children.  That to me is a good possibility.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 16, 2004, 06:30:51 PM
Quote
DaveK, and JonC I'm amazed at the points you have both raised.  What you have pointed out is something to reflect upon.  What a conspiracy!

I didn't know about sister Pascalina Lehnert. Could it be that the Orthodox church and the Catholic church were both working together to save the children.  That to me is a good possibility.


Candice, if you read over the four points DaveK made very carefully, you will see that this proves that there is no conspiracy, that a conspiracy is impossible here, which is what I have been trying to say all along. If JonC can explain to us how a conspiracy can be possible considering the four points Dave made, then I will take back everything I said before! But I really don't think that he can...

Who is Pascalina Lehnert, and what church are you talking about? Is this something from another thread or am I missing something?  ???

Helen
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 17, 2004, 02:44:52 PM
To Davek.

I am reading from the article;

' Identification of the remains of the Romanov family by DNA analysis.' from ' Nature Genetics ', Vol., 6, 2/1994.


Quote; " Identification of human remains by DNA analysis has proven to be a powerful tool in forensic investigations. The amplification of chromosomal short tandem repeat (STR) loci has been shown to have considerable potential for individual identification and has been successfully employed in the typing of bone material UP TO 15 YEARS OLD. "( emphasis mine).

And yet we read on the next page, P.131;

"....To establish paternity from 75 year-old bones, THE BEST APPROACH is to analyse SHORT TANDEM REPEATS( STR)."( emphasis mine)

In other words the above testing was totally inappropriate for 75 year old bones and yet they used it. How could they possibly expect to get perfect or even good results?

When you tell us that the Gill team used (xx) female sample to do the testing YOU LIED!

On P. 131 under the heading of ' chromosomal DNA analysis' we read;

" The sex of the bones was determined by amplification of a portion of the X-Y homologous gene, amelogenin, which provides a robust method for typing samples of a very degraded nature:..." and yet the Gill team achieved near perfect results with 75 yr old bones;it continues;
"....X and Y- specific products of 106 and 112 basepairs(bp), respectively were generated from a single primer pair.

There is no mention the above study ever being done from an (xx)gene! Where did you get THAT information? Certainlly NOT from this OFFICIAL article!

Having debunked your initial premise I find I don't need to go any further. I therefor still believe Prince Phillip's DNA WAS used to 'HOAX' the public.

As far as the 4 seperate MtDNA samples from 4 seperate individual relatives needed to do the study goes, that has not been proven to even have happened. WHY?

The Gill team 'says' that it did perform the necessary DNA study on what was identified by the Russians, and handed over to them, to be the bones belonging to 'children'. To this day, correct me if I'm wrong, that particular study has NEVER been released to the public. Why?

DaveK, I'm perplexed with your actions. You summoned me to a private discussion concerning Dr. Knight's work and when you 'thought' my answer indicated I didn't know all the answers to your 'contamination' question you pounced onto the AP site with an 'EUREKA' and an 'I'm sorry if I upset you for doing so' after the fact statement announcing to the whole world that JonC., doesn't know anything else about the 'fresh blood' 'conspiracy'. Just who are you? and What is YOUR agenda?
Title: Re: New study questions identity of Romanov bones
Post by: Candice on October 17, 2004, 04:30:16 PM
Helen, I was referring to AGRBear's article on Pope Pius XII's housekeeper, Sister Pascalina Lehnert.  She claimed that she met the Grand Duchesses Olga and Maria at the Vatican where Pope Pius received them secretly and gave them money.  

I also think that JonC has a point.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 17, 2004, 04:32:06 PM
Dave makes very valid points, and no, HE DID NOT LIE about the sex testing, or other things. Sex testing is done via XY homologous gene, whether testing for male or female types. Once again, and very obviously, JonC only understood a very small portion of all this, if at all, yet he feels that he understands it well enough to condemn someone else's correct assessments. I wish JonC would refrain from verbally attacking others who actually understand the science behind it much better than he does... Not only that, but JonC, armed with his evidently very meager scientific understanding, somehow feels justified in blatantly slandering scientists who performed this work, not to mention other members of this forum who are trying to clarify it with facts  because these facts go against JonC's own theories... This is very disturbing.
Dave, since this is your posting he is attacking, and since I refuse to speak to him directly, I will allow you to respond to JonC's attack, defend your statements and explain exactly what you were talking about here. Thank you.

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 17, 2004, 04:40:59 PM
Quote
Helen, I was referring to AGRBear's article on Pope Pius XII's housekeeper, Sister Pascalina Lehnert.  She claimed that she met the Grand Duchesses Olga and Maria at the Vatican where Pope Pius received them secretly and gave them money.  

I also think that JonC has a point.


Candice, thanks for this clarification, but what does this Pascalina Lehnert have to do with this thread? Perhaps you were confused when you posted it.  ???

I am sorry to say, but JonC really does not seem to know what he is talking about in his last post... while injustifiably accusing someone, who apparently does know what he is talking about, of being a liar...
But I want to let DaveK explain this, as it was his post...  And hopefully he will soon!

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Candice on October 17, 2004, 05:29:20 PM
Helen, sorry I did confuse threads.
Title: Re: New study questions identity of Romanov bones
Post by: Candice on October 17, 2004, 05:44:44 PM

I must say that DaveK does make valid points, I was under the impression from reading this thread that DaveK and JonC were on the same track.  Frankly, I'm a little perplexed.  I look forward to DaveK's reply.

Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 17, 2004, 07:06:40 PM
Helen.

I, like you, read DaveK's post and he distinctly said that the testing was done on what he clearly said was from a(xx) female gene. He said the testing sample was from a female. The article says the results were obtained from an ( x-y) homologous gene which DaveK called a male gene...his words not mine. Nowhere in the article does it say that the sample was from a female. If I missed it then point it out to me!

If you have a copy of the Nature Genetics article maybe you can tell us all what it means since 'obviously' I have limited scientific understanding. If you don't I can post it for you.
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 17, 2004, 11:56:15 PM
Dear Jon:
I am very disappointed at how you reacted to my last posting. You don’t have the least cause for calling me a liar, let alone ability to produce any intelligent communication. You need to learn how to debate properly or not get involved in these types of discussions.

Your last posing stunned me. It inadvertently showed how ignorant you are in this subject. You don’t even understand an extremely basic genetic principle such as Mendel's Law, difference between genotype and phenotype, let alone molecular biology or molecular anthropology. And anything you don’t understand must be a LIE.

I don’t know where to begin. But let me try to explain:

I just checked Dr Gill paper again very carefully, under the “sex testing” paragraph (p.131) and I stand by everything I said in my previous posting. First of all, you have no clue about what “Sex typing by PCR” means.  Males have XY and females have XX chromosomes. Nine bodies contains either XX or XY. Gill tried to figure out which bodies have XX or XY. He extracted genomic DNA and used PCR method with two primers against gene amelognin. This gene amelogenin’s loci are found on both X and Y chromosome, that’s why Gill said “amplification of a portion of the X-Y homologous gene amelogenin.” (If you think Gill's lying, refer NIH’s GeneBank website:  http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=46329) Here, you completely misunderstood that Gill typed “only XY”. It doesn’t even make sense. When Gill said “four male, and five female bodies were identified using this method”, it meant that male bodies produced two PCR produts 106bp+112bp (therefore XY), while all female bodies produced only 106bp products (therefore XX). This means all daughters and Tsarina’s DNA produced XX type.

Please ask someone who know this subject such as Dr. Knight, if you don’t understand this. I am sure you think I am a KGB or Freemasonry agent whispering a devilish lie. But I am writing this for someone who is watching this topic.

Regarding to 75/15 years matter, you now have English problem. First, let’s read this English sentence:
“My neighbor Eric’s old car drives up to 15 miles/h, but our new car can drive as fast as 75 miles/h.”
Now, read this: “Previous study done by other lab showed that DNA from up to 15 years old can be used for STR, but our lab are successful using it for as old as 75 years old bone.” Got it?
This advance of technology is the whole point of this paper. That’s why Nature Genetics accepted it and the genetist Paul Debenham called it “the state of the art”. I quote:  “This intriguing scientific investigation illustrates the insights that can be achieved using state of the art genetic techniques and delivers credible conclusions” (Nature Genetics vol.6, page 113)

When you finish taking Biology 101 class, read and compare Knight and Gill paper again. The way Knight extracted, isolated and purified DNA are far less sophisticated and grossly suboptimal, although his paper came out ten years later.

I don't even discuss 4 different DNA part. Even some professional geneticists misconstrue this part, there is no way to explain to you who doesn't know basic of basic.

This may be my last response to you. I no longer have intention to communicate with someone who calls people are liar just because he/she doesn’t understand it.

Regards,
Dave




   

Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 18, 2004, 12:18:48 AM
Guys - while I understand you may have a disagreement - or many disagreements, I must insist that from this point on, the name calling must stop, right now, period, end of story.

I too have strong opinions on this issue. I am perplexed as to why Dr. Knight has not explained some of the serious questions that have been raised about his work on this Forum. I am absolutely furious that some people have chosen to baselessly accuse Dr. Gill of unethical behavior. Because I feel that some people do not understand the science involved, it would be better for me to simply not engage in this discussion.

This Forum is for discussion. It is not the place to settle scores or engage in character assassination. It is not a place to call anyone, and I mean, anyone, a name.

Stop it now or this thread will be locked.
Title: Re: New study questions identity of Romanov bones
Post by: ChristineM on October 18, 2004, 04:19:27 AM
Dear Lisa

I totally agree with you.   Thank goodness a line is being drawn under this never-ending point scoring.    What use science without civility?

tsaria
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 18, 2004, 08:38:52 AM
Lisa,

It is so frustrating to witness how facts are blatantly twisted due to someone's ignorance (and agenda) while competent and honest professionals are maligned in the process. Yes, you are right, this discussion has now got to a point where it's become counterproductive. It is impossible to discuss something like this with someone who believes he knows and understands it all while understanding very little. Instead of actually teaching himself about some of these things before making any inflammatory statements, this person chooses to go on the offensive against others who present facts he does not like, and as someone else mentioned, accuse what he does not understand of being lies. This "earth is flat and you are a heretic" mentality does not belong on this forum. There is no appropriate way of dealing with such people, other than just ignoring them, but sometimes that's difficut to do because others who are unclear about certain facts start believing what these people are saying and that is not fair.
DaveK, thanks for your post, I doubt any of this will penetrate where it should, but at least maybe some other, more reasonable people will undestand that you did not lie about any of this and that you don't have an agenda to prove or disprove this case, you just presented facts...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 18, 2004, 08:53:07 AM
I am quite glad that we now have a wide spread of users, in many timezones, like LA and Scotland, so that I can get a little sleep on a Sunday night.  :P

Jon,
Dave's science is exactly correct. Your comments indicate that while you have only a minor understanding of genetics, you need to learn more in order to dive into "the deep end of the pool" where you are now. While I personally am not a geneticist, I have spoken to several Genetic experts about the studies and must tell you that Dave is spot on correct, and your interpretation is wholly incorrect. SO
personal attacks will cease.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 18, 2004, 09:01:16 AM
Quote
I am quite glad that we now have a wide spread of users, in many timezones, like LA and Scotland, so that I can get a little sleep on a Sunday night.  :P

Jon,
Dave's science is exactly correct. Your comments indicate that while you have only a minor understanding of genetics, you need to learn more in order to dive into "the deep end of the pool" where you are now. While I personally am not a geneticist, I have spoken to several Genetic experts about the studies and must tell you that Dave is spot on correct, and your interpretation is wholly incorrect. SO
personal attacks will cease.


Thank you FA for confirming this with a third party. And if JonC still doesn't believe these facts, he can ask his friend Dr Knight to explain it to him, as DaveK suggested. Now you see why it is so frustrating to try to present objective scientific facts and in return get snowballed with absurd arguments...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 18, 2004, 10:33:25 PM
I abhor pseudoscience. It makes use of some of the superficial trappings of science but does not involve the substance of science to deceive scientifically gullible people, who are unfortunately majority of the society. I will try to dissect their deceptive technique whenever I find it. Here is one:

I found the posting that is trashing DNA result by Peter Gill without any reason. (it was posted by “_Rodger_” on June 29th.) It says “The problem Lisa, is that the tested Victorian lineage doesn't match the Gill results. This isn't too surprising because there is published variance at position 16111 between T and C in several female line QV descendants, with no heteroplasmy.  This variance is published in Purple Secret: Genes, Madness and the Royal House of Windsor, London, 1998.” (emphasis by me)

What the authors of book “Purple Secret” claim are actually completely opposite (p263). There is no “variance” at position 16111. If there is a variance, it means that bone is not from Victoria’s lineage.

Here is what they did: Authors obtained two mtDNA sequences from Princess Charlotte’s grave and Princess Feodora’s grave. Two sequences were compared to Gill’s published sequence (because they thought that it is the authentic source.) Result:
1)      mtDNA from Charlotte’s grave matched Prince Philip's mtDNA.  
2)      mtDNA from Feodora’s grave did NOT match Prince Philip's.
3)      Authors' conclusion: bones in Feodora’s grave are NOT princess Feodora's. It must be mixed up with someone else’.

This book (p245) also showed how other scholars regard Gill’s sequence as an authentic source when they analyzed Anna Anderson’s DNA.

I also want to point out that their sequence of Princess Charlotte matched to Gill’s sequence again. For people who demand repeated sequencing from other royal family, this is it.  

By the way, I dot not think Dr. Knight’s study is a pseudoscience. I would say it’s “junk science” according to Wikipedia’s definition. “Junk science is a term used to derogate purportedly scientific data, research, analyses or claims which are driven by political, financial or other questionable motives.”
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 18, 2004, 11:03:51 PM
Hi daveK,

Thank you very much for all your erudite comments. ;D
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 18, 2004, 11:34:36 PM
Helen:

I want to thank you for staying cool under pressure with this thread and for your many well reasoned posts. You did good!

DaveK:

The original shill on this Board for the Knight report, "Rodger", freaked out when I told him that private testing had been conducted on Princess Katherine of Yugoslavia, a maternal line Victorian descendant, BEFORE a sample was requested from Prince Philip. These tests were conducted in the United States and their results were completely unknown until a few years ago. However, they exactly matched Philip's mtDNA. I am not a scientist, but I would imagine these tend to strengthen the results obtained by Dr. Gill. Oh, and they blew "Rodger's" conspiracy theory all to hell.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 19, 2004, 12:19:29 AM
Quote
... they blew "Rodger's" conspiracy theory all to hell.


And, I believe I wouldn't be wrong in saying that DaveK just did the same to JonC's...  ;)

And now, we can all continue to sit tight and wait very impatiently for Dr Knight's new paper...  ;D

Helen


Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 19, 2004, 12:21:55 AM
Quote
The original shill on this Board for the Knight report, "Rodger", freaked out when I told him that private testing had been conducted on Princess Katherine of Yugoslavia, a maternal line Victorian descendant, BEFORE a sample was requested from Prince Philip. These tests were conducted in the United States and their results were completely unknown until a few years ago. However, they exactly matched Philip's mtDNA. I am not a scientist, but I would imagine these tend to strengthen the results obtained by Dr. Gill. Oh, and they blew "Rodger's" conspiracy theory all to hell.


I wonder if this revelation explains why we have not heard anything about a follow-up paper? ;) Hmm!
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 19, 2004, 09:43:05 AM
Our suspicion, which may of course be wrong, is that no peer-review publication has yet accepted the new Knight paper. Dr. Knight declined to name the specific journal when asked, which led us to conclude that it had not yet agreed to publish the work. His answer of "any day know, very very soon" does not jibe with the rather long period of several weeks now, without a word.
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 19, 2004, 10:49:27 AM
P.S.
Just to clear things up,  Princess Charlotte and Tsarina Alexandra were first cousisns and they were both daughters of Queen Victoria's daughteres. Feodora was a Charlotte's daughter. They all inherited the same mtDNA of Queen Victoria.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 19, 2004, 11:32:53 AM
Quote
Our suspicion, which may of course be wrong, is that no peer-review publication has yet accepted the new Knight paper. Dr. Knight declined to name the specific journal when asked, which led us to conclude that it had not yet agreed to publish the work. His answer of "any day now, very very soon" does not jibe with the rather long period of several weeks now, without a word.


I suspect you may be correct about that... Which means we may or may not ever see this new paper.  
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 19, 2004, 11:35:55 AM
Quote
P.S.
Just to clear things up,  Princess Charlotte and Tsarina Alexandra were first cousins and they were both daughters of Queen Victoria's daughters. Feodora was Charlotte's daughter. They all inherited the same mtDNA of Queen Victoria.


Dave,

Which one of QV's daughter's was Charlotte the daughter of?  Was it Beatrice or Helena? There were so many daughters, it's difficult to keep them all straight  :).  For our intents and purposes that doesn't really matter here, but I am just curious... Do the authors mention when Feodora died and under what circumstances, that her body may have been mixed up with someone else's? That sounds a little odd. Again, no relevance to this, just pure curiousity... Thanks!

Helen
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 19, 2004, 12:10:16 PM
Helen,
I am no royal family expert (remember I am just a guy who watches CSI), but here is info from the book:
------------------------------------------------------------------
Queen Victoria (Alexandrina Victoria )(1819-1901)
------------------------------------------------------------------
Her daughter: Victoria (1840-1901) Princess Royal Crown Princess of Prussia and German Empress
------------------------------------------------------------------
Victoria’s daughter: Charlotte (1860-1919) of Prussia
------------------------------------------------------------------
Charlette’s daughter: Feodora (1879-1945) of Saxe-Meiningen
Title: Re: New study questions identity of Romanov bones
Post by: Candice on October 19, 2004, 01:36:44 PM
DaveK, " mtDNA from Feodora's grave did NOT match Prince Philip's mtDNA."  Was it totally different or did it not match in only some places.

Is there a site where one can view the results and comparisons?

Regards,
Candice
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 19, 2004, 01:45:40 PM
Quote
Helen,
I am no royal family expert (remember I am just a guy who watches CSI), but here is info from the book:
------------------------------------------------------------------
Queen Victoria (Alexandrina Victoria )(1819-1901)
------------------------------------------------------------------
Her daughter: Victoria (1840-1901) Princess Royal Crown Princess of Prussia and German Empress
------------------------------------------------------------------
Victoria’s daughter: Charlotte (1860-1919) of Prussia
------------------------------------------------------------------
Charlette’s daughter: Feodora (1879-1945) of Saxe-Meiningen


Thanks, Dave. Charlotte is Kaiser Wilheim's sister then. (BTW, Keiser Wilheim has the same mtDNA as all these guys) I wonder if Feodora's death had something to do with WWII, in which case it may make sense that her body was mixed up with someone else's ...  And Charlotte's mtDNA matched Philip's, so that just confirms Gill's results once more.  

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on October 19, 2004, 03:18:01 PM
It makes you wonder if this "supposed" paper is going to be published at all.It really doesn't seem like it's going to to me.I was looking so forward to reading it too and seeing what kind of crack pot stuff was in it. ;D
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 19, 2004, 07:39:18 PM
Quote
DaveK, " mtDNA from Feodora's grave did NOT match Prince Philip's mtDNA."  Was it totally different or did it not match in only some places.

Is there a site where one can view the results and comparisons?

Regards,
Candice


Candice, it doesn't matter if this mtDNA was totally different or only a little different, it didn't match to Charlotte's (Queen Victoria's granddaughter and Feodora's mother),  nor to Prince Philip's, which means that the remains in this grave were not those of a maternal descendant of Queen Victoria.... Are you trying to figure out whose DNA it did match?  Please PLEASE don't propose another conspiracy theory!  ::)

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 19, 2004, 07:46:07 PM
Quote
It makes you wonder if this "supposed" paper is going to be published at all.It really doesn't seem like it's going to to me.I was looking so forward to reading it too and seeing what kind of crack pot stuff was in it. ;D


Merrique,

We were all looking forward to seeing this paper, but it is beginning to look like it just isn't happening... Too bad but not a big surprise...

H
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 19, 2004, 07:59:17 PM
I just got this bit of info about the circumstances of Feodora of Saxe Meiningen's very morbid
death, if anyone is interested:

"Princess Feodora entered into a suicide pact with her companion and gassed herself in an oven..."

Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 20, 2004, 01:46:17 PM
All this new evidence proves that what helen azar has been advocating for past month were all correct!!
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 20, 2004, 01:47:16 PM
Well, gee, I'm surprised they have kept Litwin "officially" onboard, too! ;)

Thanks very much for all this new information, Dave.
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 20, 2004, 01:51:05 PM
Thank you Dave! The "contamination" theory doesn't hold water. Neither it seems, does the claim that the samples were "too old" for the results obtained. I hope this will stop all the talk to the contrary now. I for one believe the US Armed Forces DNA Identification Lab certainly knows what they are talking about.
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 20, 2004, 01:52:58 PM
sorry, because of copy right issue with my library, i had to remove the post.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 20, 2004, 01:59:57 PM
Dave, if you've time, would you mind posting the citations for the articles/letters, so that others can locate them in the journal and/or databases? Thank you.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 20, 2004, 02:42:50 PM
Thank you Dave for this information. I actually had the chance to read it all before you took it off the board, and yes, basically all of it was almost identical to what I have been saying all along. I am glad that Dr Gill finally responded to all this nonsense, I wonder what took him so long.... Did anyone else see it and notice that all these letters were published only a few days ago, on October 15th? So while we were discussing all this here on this board, they were all preparing these statements.

Interestingly, in Alec Knight's rebuttal, he just keeps parroting the same things we already heard here on this very thread: that "truly independent tests" have to be done again "given present knowledge and inconsistencies" before we can accept Gill's results. Sound familiar?  ;) He keeps saying there was a contamination, but he doesn't explain how a contamination occured in such a way as to produce conclusive DNA results, or any of the other issues that make this impossible. I am wondering, has he finally gotten himself so confused that he doesn't even know what is a legitimate result and what isn't? And I am also wondering why in his response, Dr Knight makes no mention whatsoever of his alleged new paper which is supposedly coming out any day now and which supposedly will explain everything...  Perhaps our suspicions are correct and no self respecting journal was willing to accept the new paper, not even Annals of Human Biology which for some strange reason was willing to accept his last paper without questioning it.  
I have a feeling that unfortunately for him, Dr Alec Knight will soon come to regret the day he heard the name "Daryl Litwin". I actually say this with a lot of sympathy towards him   :(.


Quote
sorry, because of copy right issue with my library, i had to remove the post.

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 20, 2004, 02:46:01 PM
Quote
Dave, if you've time, would you mind posting the citations for the articles/letters, so that others can locate them in the journal and/or databases? Thank you.


Dashkova, I happend to copy everything Dave posted before, so here is the citation where all the letters can be found: Science, Vol 306, Issue 5695, 407-410 , 15 October 2004 .
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 20, 2004, 02:49:55 PM
I think the very most damning point made, should be made again. Dr. Gill sequenced the Ekaterinburg remains BEFORE a single sample was taken from Prince Philip, so there is NO possible way for the alleged contamination to have occured. I didn't see any rabbits out of a hat from Dr. K's response to explain this.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 20, 2004, 03:04:04 PM
Quote
I think the very most damning point made, should be made again. Dr. Gill sequenced the Ekaterinburg remains BEFORE a single sample was taken from Prince Philip, so there is NO possible way for the alleged contamination to have occured. I didn't see any rabbits out of a hat from Dr. K's response to explain this.


Yes, this is exactly what I meant when I said that Knight makes accusations but doesn't back them up, he just throws them out there.  But how can he give an explanation if there are no explanations?
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 20, 2004, 03:07:14 PM
Quote
 
  Perhaps our suspicions are correct and no self respecting journal was willing to accept the new paper, not even Annals of Human Biology which for some strange reason was willing to accept his last paper without questioning it.  





Check the editorial board of this Annals of Human Biology. One of editor is L A Zhivotsky. Sounds familiar? Isnt’ he the co-author of Knight paper? Spelling is not same, but I think it is a typo (I’ll ask the  journal to clear it up). If so, authors are submitting a paper to a journal where author himself is a judge? I am sure that it was also reviewed by multiple revieweres other than him, but this explains a lot.
---------------------------------------------------------
Annals of Human Biology
Editorial Advisory Board:
K Aoki - Tokyo, Japan
K. ASHIZAWA - Tokyo, Japan
A. D. G. BAXTER-JONES - Saskatoon, Canada
G. P. C. BEUNEN - Leuven, Belgium
------------
M. VAN T'HOFF - Nijmegen, The Netherlands
W. WANG - Beijing, China
J. WOROBEY - New Brunswick, USA
L A Zhivotsky - Moscow, Russia
---------------------------------------------------------
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 20, 2004, 03:13:10 PM
Yes, that is bound to be Lev Zhivotovsky, just a typo. And yes, co-author of the Knight paper, also known to have worked with author Shay McNeal.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 20, 2004, 03:16:18 PM
Quote
Check the editorial board of this Annals of Human Biology. One of editor is L A Zhivotsky. Sounds familiar? Isnt’ he the co-author of Knight paper? Spelling is not same, but I think it is a typo (I’ll ask the  journal to clear this out). If so,  authors are submitting a paper to a journal where author himself is a judge? I am sure that it was also reviewed by multiple revieweres other than him, but this explains a lot.
---------------------------------------------------------
Annals of Human Biology
Editorial Advisory Board:
K Aoki - Tokyo, Japan
K. ASHIZAWA - Tokyo, Japan
A. D. G. BAXTER-JONES - Saskatoon, Canada
G. P. C. BEUNEN - Leuven, Belgium
------------
M. VAN T'HOFF - Nijmegen, The Netherlands
W. WANG - Beijing, China
J. WOROBEY - New Brunswick, USA
L A Zhivotsky - Moscow, Russia
---------------------------------------------------------


Wow could this really be Lev Zhivotovsky?! If it's really him, is this even legal for him to do this? Certainly not ethical! If this is really the Lev Zhivotovsky who is working with Alec Knight, then that explains a lot, this is why this paper got accepted in Annals of Human Biology and not any other paper! Unbelievable. Let us know when you find out, Dave. Thanks again.

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 20, 2004, 03:19:10 PM
Quote
Yes, that is bound to be Lev Zhivotovsky, just a typo. And yes, co-author of the Knight paper, also known to have worked with author Shay McNeal.


Well, Knight cites McNeal in his paper at least three times, so obviously McNeal was very involved as a consultant. Scary!

H
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 20, 2004, 03:21:02 PM
Here is the URL for Lev A. Zhivotovsky's homepage, complete with photo:

http://genetics.biology.kyushu-u.ac.jp/pgen/staff/lz.htm
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 20, 2004, 03:26:34 PM
Quote
Dave, if you've time, would you mind posting the citations for the articles/letters, so that others can locate them in the journal and/or databases? Thank you.


sorry about it. i am using a public terminal and my library has a big sign that says they will prosecute offender when they find it. but helen posted.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 20, 2004, 03:39:45 PM
Quote

sorry about it. i am using a public terminal and my library has a big sign that says they will prosecute offender when they find it. but helen posted.


Dave, you are like our very own "Sherlock Holmes"! It is amazing, the kind of information you were able to provide us with here. These "conspiracy theorists" just had no idea whom they were going up against.  Notice, JonC now seems to have dissapeared off this thread...or at least he stopped posting.  And here we were, thinking you were just a regular guy who watches CSI all the time  ;D  ;)

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 20, 2004, 03:48:10 PM
Quote
Here is the URL for Lev A. Zhivotovsky's homepage, complete with photo:

http://genetics.biology.kyushu-u.ac.jp/pgen/staff/lz.htm


He is the same guy who is posing with Alec Knight and the "Elizabeth finger" DNA sequence, on Knight's website, right? So basically, it seems like he is the one who is running the show here, considering he wrote a paper about this initially in 1999 (published in Annals as well) and probably he had Alec Knight do a follow up this year. He is on the board of this journal, albeit it's an inferior one, but a scientific journal nevertheless, so he can basically almost guarantee publication for all this stuff. If there is another paper from that camp, I am pretty sure it will be published in Annals as well. In addition, isn't he somehow connected to ROC, I keep forgetting how, and they want these bones proven not to be the IF. So it all comes together and makes sense. Oh what tangled webs...  :-/  

Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 20, 2004, 04:02:00 PM
Quote

He is the same guy who is posing with Alec Knight and the "Elizabeth finger" DNA sequence, on Knight's website, right?



One and the same.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 20, 2004, 06:51:33 PM
Quote
I found the posting that is trashing DNA result by Peter Gill without any reason. (it was posted by “_Rodger_” on June 29th.) It says “The problem Lisa, is that the tested Victorian lineage doesn't match the Gill results. This isn't too surprising because there is published variance at position 16111 between T and C in several female line QV descendants, with no heteroplasmy.  This variance is published in Purple Secret: Genes, Madness and the Royal House of Windsor, London, 1998.” (emphasis by me)



Hey, look at this, the above is an excerpt from a posting by "Rodger" back in June, DaveK found it and posted on this thread the other day. And below is an except from Alec Knight's rebuttal letter from Science, published this week, October 15th:

"...the mtDNA of another relative, Princess Feodora, was found to have a C at position 16111, whereas her mother Princess Charlotte had a T at that position (15).

 15. J. C. G. Röhl, M. Warren, D. Hunt, Purple Secret: Genes, "Madness" and the Royal Houses of Europe (Bantam, London, 199 ."


Couldn't you even come up with original lines? Do you have to spoon feed each other everything and even use the same lines for a rebuttal letter in a scientific journal?  Your logic here is still flawed, as it has been right from the beginning...

Another thing I noticed is that in the rebuttal, many of the citations Knight and company use are mainstream books, as opposed to scientific papers! They wrote this letter intending to publish it in Science, the most prestigious scientific journal in the world, in order to defend their scientific work, and yet they have to rely on so many non-scientific publications for their citations? This is getting to be very embarassing...

Helen

Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 20, 2004, 08:46:21 PM
-----Quick note to non-science readers: regarding Annals of Human Biology-----

As I found few news media report this “controversy”  in a proper context, this piece may help AP audiences who are unfamiliar with how science works within academic community.

Misconception #1: Knight’s study must be a big discovery, because it was published in a distinguished peer-reviewed journal “Annals of Human Biology”.

Of course, this topic’s initiator Helen has been pointing out the logical flaws in the paper, but I also want to add something.

Never do I intend to instruct people to judge the book’s content by its cover, but the journal ranking is a good guidance for non-science [/font]people. How do you judge which journal is authentic or important among more than 5000 biomedical journals? People in science community use what is called “Impact Factor (IF)”. It’s available at http://molbiol.edu.ru/eng/journals/index.html

It is a citation index, indicating how many times the articles in a particular journal are cited for a certain period. The more important the paper is, the more often it is likely to be cited by other authors, resulting higher Impact Factor number. For example, top journal’s Impact Factors are: Nature (31.0), Science (29.1), Cell (26.6), and Nature Genetics (26.5). You can see the Nature Genetics, which published Peter Gill’s paper, has an extremely high impact factor.

There are almost 100 biomedical journals, which are generally considered a well-distinguished “top journals” that have Impact Factor more than 10. As one of most important factor determining your promotion in academic field is the publications in a journal with high impact factor, all scientists submit their article to top journals first. If it is rejected, then submit to the journal with a little bit lower Impact Factor. They repeat this until it is accepted.

If you can’t publish it in any top journals, you have to go down to “good journal”. Under Impact Factor 10, there are almost 300 good journals that has Impact Factor more than 4. But what if your paper is still rejected? Don’t worry, there are almost 2000 journals that has IF more than 1.0!

So where is Annals of Human Biology? Actually, its IF is mere 0.8 (year 2003 data). It's even less than 1.0.  In fact, many scientist choose not to publish at all rather than publishing in a low IF journal, because it may hurt their career.

So, after the first Knight’s paper was rejected by Nature Genetics, I would imagine he suffered numerous rejections by almost all reviewers in all journals. As I posted before, at least one of reason he chose Annals of Human Biology is that one of its editor, Lev A. Zhivotovsky, is the Knight's co-author.

What is puzzling me is that Knight is also publishing a fairly good paper with solid science in a good journals (Current Biology, IF 11.9) at almost same time http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=12646128. There is no need to publish this "finger DNA" paper, which may actually mar his career. Why is he so obsessed with this paper, as if under a spell by someone? Why? It's a mystery.

I have to stress that the quality of study does not always correlate with Impact Factor. Top journals may have a questionable work with unreliable data, while low IF journals often have small “gem” paper. It is always incumbent on readers to judge the significance of paper by your own skeptical scrutiny. Nevertheless, I believe that knowing the process behind the scene may provide guidance for non-science lay persons to comprehend the paper in a proper perspective, as we do distinguish New York Times and The National Enquirer. I use it all the time.


(It’s also ironic that I am writing this in internet board with anonymity. So use all info here as a “guidance” with your own judgment!)
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 20, 2004, 10:07:16 PM
After my careful reading of the new letter article, I was very disappinted to find that there was nothing new or substantial  from both Knight/Gill sides. I found a couple of more points to make in both Gill/Knight original paper. I will try to put it in this site soon.
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 20, 2004, 10:31:48 PM
Hi daveK,

I welcome your interpretations concerning Gill and Knight's original published papers. Is there any possibility in writing up a summary of the entries from the latest Science? Unfortunately not all of us are able to access this J.

Thanks for your help in advance. :D
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 20, 2004, 10:40:57 PM
Actually, if you follow all the threads, what helen (topic initiator) has been discussing is much more original and informative than new letters. so I don’t want to repeat it. What I want to discuss is something else. I will come back later when i sort it out.
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 21, 2004, 02:12:59 AM
It is a regretable co-incidence that one of the co-authors is a member of the Editorial Board of the Annals of Human Biology.  ;)

The following link below lists all the prestigious medical and scientific journals which are peer reviewed. Interestingly, Annals of Human Biology does not appear among them:

http://www.eurekalert.org/links.php?jrnl=A



Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 21, 2004, 08:44:30 AM
Quote
It is a regretable co-incidence that one of the co-authors is a member of the Editorial Board of the Annals of Human Biology.  ;)



Yes, quite an amazing coincidence!  ;)
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 21, 2004, 09:30:32 AM
Quote
Unfortunately not all of us are able to access this J.


Belochka,

I am going to try to post them later, as I do have copies...

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 21, 2004, 01:49:13 PM
Here is the first letter to the editor published in the October 15, 2004 issue of Science, written by a group of scientists from Max Planck Institute and Armed Forces DNA Identification Laboratory.

Ongoing Controversy over Romanov Remains  The field of ancient DNA analysis has faced numerous obstacles and setbacks in its path to legitimacy. Yet another setback was showcased in the news story "Buried, recovered, lost again? The Romanovs may never rest" (R. Stone, News Focus, 6 Feb., p. 753). Much was made of a report by A. Knight et al. (1) that claimed to be a failed attempt to "replicate the findings" of a previous DNA analysis of the putative remains of Tsar Nicholas II of Russia, the Empress Alexandra, and three of their daughters (2).  Knight et al. did not, in fact, test the skeletal material in question, but used a new maternal reference sample for Alexandra: an 86-year-old finger putatively from Alexandra's sister, Grand Duchess Elisabeth of Russia. We cannot see why anyone would consider this a superior DNA source to the modern-day blood sample from Alexandra's grandnephew Prince Phillip of Great Britain that was analyzed previously. Moreover, the finger showed a mixture of mitochondrial DNA (mtDNA) sequences from different individuals, and in two of four amplifications showed a minority sequence that matched a rare sequence motif shared by Prince Phillip and Alexandra. The results of Knight et al. end in a fizzle. The fuss has been caused by their claim that recent developments in the ancient DNA field (3, 4) constitute "certai  n evidence" of the fallacy of the Gill et al. (2) testing, because of amplicon sizes involved.  This bald assertion naively elevates a well-established truism of ancient DNA--that it is fragmented in length--to categorical law, ignoring the breadth of ancient/forensic DNA literature and experience and the range of considerations that are part of determining ancient DNA authenticity. Knight et al. repeatedly assert that DNA fragments greater than 250 base pairs (bp) do not exist in samples as little as 70 years old. However, DNA preservation depends on both the age of a sample and the environmental context, with comparatively cold temperatures greatly favoring DNA preservation (5, 6). Instances of remarkable preservation include recovery of a 1.7-kb fragment of a single-copy gene from a 156-year-old dried specimen (7), 1.6 kb from 560-year-old avian bones ( , and 438 bp from a 3350-year-old moa bone (9). Successful amplification of 522 bp of mtDNA from a 20,000-year-old ground sloth coprolite from Utah (10) suggests that amplification of DNA fragments twice that length from bones 300 times younger is far from implausible. Moreover, Knight et al. fail to acknowledge that the 1223-bp amplicons of Gill et al. (2) were used only in the first round of a 62-cycle nested PCR protocol.  We explored the use of nested and non-nested PCR on six degraded skeletal extracts of known authentic sequence: ~60-year-old bones of three individuals recovered from a crash in temperate coastal Alaska (from a lower latitude than the Romanov remains) and three from temperate Asia (~50 years old). Using standard single round PCR, we did, in fact, obtain successful PCR and authentic sequence with 1200-bp amplicons for two of the three Alaska bones, but not with any others. However, when a nested protocol similar to Gill et al. (2) was employed using 1200-bp primers in the first round and 221-bp primers in the second, we obtained authentic sequence from all three Alaskan bones and two of the Asian bones. These results suggest there is nothing implausible about the results of Gill et al. (2).  Knight et al. fail to cite the replication of mtDNA results of the Tsar in an independent laboratory with different methods (11), an important criterion of ancient DNA authenticity. Furthermore, another criterion of ancient DNA authenticity in the Romanovs is also met: The results make sense in the genetic context of the investigation. The nuclear short tandem repeats (STRs) are consistent with a mother, father, and three daughters, and there is an mtDNA link of the mother to Prince Phillip, an mtDNA link of the father to living relatives, and shared heteroplasmy with the Tsar's brother (11). The chances that these results are from contamination are astronomically slim.  As no reasonable alternate explanation for the data is apparent, or has been offered, we conclude that there is no scientific reason to refute the identification of the Romanovs. Although ancient DNA research will always remain prone to artifacts because of contamination, requiring carefully conducted studies, it should not be put out of the realms of science into some mystic sphere where generalized criteria suggested in review articles are used as dogma to refute otherwise indisputable scientific results.  

Michael Hofreiter, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, D-04103 Leipzig, Germany.  Odile Loreille, Armed Forces DNA Identification Laboratory, 1413 Research Boulevard, Rockville, MD 20850, USA.  Deborah Ferriola, Armed Forces DNA Identification Laboratory, 1413 Research Boulevard, Rockville, MD 20850, USA.  Thomas J. Parsons Armed Forces DNA Identification Laboratory, 1413 Research Boulevard, Rockville, MD 20850, USA.  

References    

1. A. Knight et al., Ann. Hum. Biol. 31, 129 (2004).    

2. P. Gill et al., Nature Genet. 6, 130 (1994).    

3. M. Hofreiter et al., Nature Rev. Genet. 2, 353 (2001).    

4. A. Cooper, H. Poinar, Science 289, 1139 (2000).    

5. E. Willerslev et al., Curr. Biol. 14, R9 (2004).    

6. C. I. Smith et al., J. Hum. Evol. 45, 203 (2003).    

7. D. M. Hunt et al., Science 267, 984 (1995).    

8. D. M. Lambert et al., Science 295, 2270 (2002).    

9. A. Cooper et al., Proc. Natl. Acad. Sci. U.S.A. 89, 8741 (1992).  

10. H. Poinar et al., Curr. Biol. 13, 1150 (2003).  

11. P. Ivanov et al., Nature Genet. 12, 417 (1996).
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 21, 2004, 01:56:27 PM
This is the second letter by Peter Gill and associates, published in the same issue:

Richard Stone's news story "Buried, recovered, lost again? The Romanovs may never rest" (News Focus, 6 Feb., p. 753) highlights a study by A. Knight and colleagues in which they analyzed a shriveled finger said to be from Grand Duchess Elisabeth, a sister of Empress Alexandra of Russia (1). They recovered a mitochondrial DNA (mtDNA) sequence of unknown origin from the finger and concluded that the previous identification of the remains found at Ekaterinburg, Russia, as the Romanovs (2) was inconclusive.

The arguments of Knight et al. are illogical. The claim that they identified the correct mtDNA sequence is not substantiated, and their anecdotal evidence of the origin of the finger is irrelevant to this DNA evidence. Their reported mtDNA sequence did not match that previously obtained from remains formally identified as those of Alexandra and three of her daughters, and from blood from Prince Philip, the Duke of Edinburgh, a known grandnephew of Alexandra (2). They also criticize the original investigation of the purported Romanov remains by physical anthropologists.

In our investigation (2), we evaluated the DNA evidence using a Bayesian approach (3). The prior odds for the non-DNA anthropological and historical evidence were obtained from a relevant expert, and we presented the DNA data in an objective probabilistic framework to allow others to reach a conclusion based on their interpretation of the DNA and non-DNA evidence. The Russian authorities accepted that the remains were those of the Romanovs after considering all the expert evidence.

Knight et al. assert that our findings were the result of contamination. Although contamination is a potential problem in the analysis of biological samples containing small amounts of DNA, such as old bones, our respective laboratories established a number of principles governing this type of work in forensic identification and ancient DNA research well before the Romanov investigation (4). In particular, Knight et al. failed to note that the DNA extractions and mtDNA sequencing of samples of the nine Ekaterinburg skeletons were replicated blindly by one of us (E.H.) in a separate laboratory (2). A key finding, the characterization of mitochondrial heteroplasmy in the putative Tsar's remains, was also replicated independently (5). The allegation that bone samples were contaminated by present-day DNA of a maternally related individual is untenable, as we approached the relatives after we had typed the bones. In addition to comparing mtDNA of the putative Romanovs with that of living relatives, the presence of a family group among the nine bodies was confirmed by STR analysis. The sexing of skeletons by physical anthropologists was confirmed by analysis of the amelogenin gene. Importantly, rather than resulting in incorrect inclusions, random contamination generates inexplicable DNA profiles that lead to exclusions (6, 7).

Knight et al. used cloning to prove that the mtDNA sequence from the Elisabeth relic was genuine, while asserting that our results were flawed. Cloning does not guarantee that the product is not contamination, because contaminating DNA can be cloned as readily as authentic bone DNA. However, we did clone the mtDNA amplification products to resolve the issue of the heteroplasmy in Tsar Nicholas, although the remaining samples gave reproducible results without cloning.

The most logical explanation of the results by Knight et al. is that the shriveled finger was not from Elisabeth or that the DNA sequence they recovered was the result of contamination. Their cloning results cannot refute these arguments. Conversely, contamination cannot explain the agreement between the mtDNA sequences of the presumptive Romanovs analyzed independently in three laboratories, or their match with DNA of known living relatives.

Peter Gill
Forensic Science Service,
2960 Solihull Parkway,
Trident Court,
Solihull B37 7YN, UK.
E-mail: dnapgill@compuserve.com

Erika Hagelberg
Department of Biology,
University of Oslo,
Post Office Box 1050 Blindern,
Oslo 0316, Norway.
E-mail: erika.hagelberg@bio.uio.no

References

 
1. A. Knight et al., Ann. Hum. Biol. 31, 129 (2004).
 
2. P. Gill et al., Nature Genet. 6, 130 (1994).
 
3. I. W. Evett, B. S. Weir, Interpreting DNA Evidence (Sinauer Associates, Sunderland, MA, 199 , pp.17-21.
 
4. E. Hagelberg et al., Nature 352, 427 (1991).
 
5. P. Ivanov et al., Nature Genet. 12, 417 (1996).
 
6. P. Gill et al., Forensic Sci. Int. 112, 17 (2000).
 
7. P. Gill, A. Kirkham, J. Forensic Sci., in press.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 21, 2004, 01:59:56 PM
And finally here is Alec Knight's et al rebuttal to the rebuttal.

The conclusion that the ekaterinburg remains were those of the Romanovs faced caveats from the forensic perspective (1) that have not been acknowledged by the authors of the DNA analyses. They did not respond to requests to provide the "raw" DNA data and for documents of chain of custody. Therefore, we, with the Russian Expert Commission Abroad, conducted an additional DNA investigation (2). As we explicitly stated, our main conclusion was based on the reported claim that the authors had obtained sequence "comparable to that produced from the fresh blood" from polymerase chain reaction (PCR) products of 1223 base pairs (bp) in length from each of nine bones (3). Generally, published results indicate that only fragments shorter than about 250 bp are obtainable from old tissues not stored in favorable environmental conditions. An independent test of the Ekaterinburg remains, carried out on teeth, was consistent with established molecular behaviors of such samples in that only very short PCR products were obtainable and sequence was of poor quality (4). Gill and Hagelberg have not addressed this central issue. Hofreiter and Parsons provide only two examples of results of similar length. One is of tissues of penguins frozen in Antarctica, and the other of carefully preserved tissues of the eye of John Dalton. Likewise, preservation of the avian bones and sloth coprolite was excellent. None of these preservation environments remotely resembles the wet soil of Ekaterinburg, where climate is continental with hot summers. Gill and Hagelberg refer to "an objective probabilistic framework." The prior probability is exceedingly low that nine badly decomposed bones, submerged in wet soil for several decades, can produce PCR products of 1223 bp in length for every tested individual. There are no other such published results. Generally, such results indicate contamination (5, 6).

One of us had suggested to Parsons that studies of bones of similar age and condition, subjected to the methods in (3), would be necessary to establish that such results were possible. Now their team has carried out experiments on bones from Alaska and Asia, a first step toward that goal. They do not provide information on results of experiments that duplicate the nested PCR method in (3), using the same PCR primers with nested products of about 400 bp in length. Instead, they obtained sequence from a 221-bp product, well within the range of degraded DNA. Sample preservation and their experimental methods and results are not published or revealed in full, and successful PCR of 1200 bp indicates excellent preservation of those two Alaska individuals. Nothing has been accomplished to indicate that the results in (3) are plausible. To the contrary, only a 221-bp amplicon could be produced (possibly from endogenous degraded DNA template), but not a 400-bp nested product. This result further supports our conclusion that the results in (3) are not plausible.

Gill and Hagelberg imply both degradation and possible misidentification of the Elisabeth sample. Elisabeth's body was identified by those who knew her and placed in a sealed coffin with her name inscribed and kept in a locked crypt. The finger included dried flesh as well as bone, indicating stable conditions of preservation. Tests of molecular behavior of the finger (2) were consistent with an old sample.

There are many shallow mass graves in the Ekaterinburg region, including entire families that resemble the remains in question (7-10). The grave had been opened many times over the decades with many bones removed and added (1, 8-10). The "discoverers" of the grave, Ryabov and Avdonin, removed three skulls in 1979, over a decade before the time of discovery reported by Gill et al. (3), and took two of them to Moscow (1, 6- . It is documented in a medical report dated 1891 and signed by three Russian naval physicians that the skull bones of the Tsarevich Nicholas had a deep scar from a sword wound (11), and there was no trace of this gash in the skull from Ekaterinburg. For purposes of facial reconstruction, crucial reference points were missing from the damaged and decomposed skulls ( . Arm and leg bones had sections removed, making it impossible to estimate individual height ( . Expert forensic physical anthropologists, including William Maples, strongly objected to the methodology and conclusions (1, 8, 9).

Our critics confuse repetition with replication. They analyzed bones provided by Russian geneticist P. Ivanov, who had access to all the samples, conducted tests, prepared a report to the Russian government, and then voted on acceptance of that report (1). Our test of Elisabeth was replication. We did not cite the tests later conducted in the United States (12) because they could have been contaminated from the same source, and the fragment lengths tested were much shorter. Heteroplasmy was not found in a sample from the Tsar's nephew (13) and apparently was not found in the Tsar's blood-soaked bandage ( . As unlikely as it is to have obtained such perfect mtDNA results, the STR results are even more unlikely without the presence of "fresh" DNA. Gill has stated, "they are probably the oldest samples from which this kind of DNA ever has been extracted" [(9), p. 104].

DNA testing by proponents of Romanov identity has been shrouded in secrecy. The possibility of a mismatch between the mtDNA of Prince Philip and that of his sister has been suggested (8, 14). Also, the mtDNA of another relative, Princess Feodora, was found to have a C at position 16111, whereas her mother Princess Charlotte had a T at that position (15). All these individuals are expected to carry the mtDNA lineage of Queen Victoria, grandmother of Empress Alexandra and Grand Duchess Elisabeth. There are over 50 living carriers of that lineage. Truly independent tests of some of these individuals, with full disclosure of chain of custody, are now necessary to establish this haplotype. Given present knowledge and inconsistencies, the Ekaterinburg remains cannot be regarded as those of Nicholas II and his family.

Alec Knight,
Department of Anthropological Sciences,
Stanford University,
Stanford, CA 94305, USA.

Lev A. Zhivotovsky,
Vavilov Institute of General Genetics,
Russian Academy of Sciences,
117809 Moscow, Russia.

David H. Kass,
Department of Biology,
Eastern Michigan University,
Ypsilanti, MI 48197, USA.

Daryl E. Litwin,
Post Office Box 19754,
Stanford, CA 94309, USA.

Lance D. Green,
Bioscience Division,
Los Alamos National Laboratory,
Los Alamos, NM 87545, USA.

P. Scott White
Bioscience Division,
Los Alamos National Laboratory,
Los Alamos, NM 87545, USA.

References

 
1. L. A. Zhivotovsky, Ann. Hum. Biol. 26, 569 (1999).
 
2. A. Knight et al., Ann. Hum. Biol. 31, 129 (2004).
 
3. P. Gill et al., Nature Genet. 6, 130 (1994).
 
4. C. Ginther, personal communication.
 
5. A. Cooper, H. Poinar, Science 289, 1139 (2000).
 
6. M. Hofrieter et al., Nature Rev. Genet. 2, 353 (2001).
 
7. A. Summers, T. Mangold, The File on The Tsar (Gollancz, London, 1976).
 
8. M. Gray, Blood Relative (Gollancz, London, 199 .
 
9. R. K. Massie, The Romanovs: The Final Chapter (Random House, New York, 1995).
 
10. E. L. Magerovsky, Trans. Assoc. Russian-Am. Scholars 28, 449 (1996-1997).
 
11. State Archives of the Russian Federation, Folder 77, Reg. 1, Doc. 701, leaves 12-13.
 
12. P. L. Ivanov et al., Nature Genet. 12, 417 (1996).
 
13. E. I. Rogaev, I. V. Ovchinnikov, P. Dzhorzh-Khislop, E. A. Rogaeva, Genetika 32, 1690 (1996).
 
14. M. Kirk, in Proceedings of International Scientific Conference on "Tsar Case and Ekaterinburg Remains," St. Petersburg, Russia, 26 to 27 April 1998 (in Russian), available at www.tzar.orthodoxy.ru/ost/mnk/8.htm.
 
15. J. C. G. Röhl, M. Warren, D. Hunt, Purple Secret: Genes, "Madness" and the Royal Houses of Europe (Bantam, London, 199 .
Title: Re: New study questions identity of Romanov bones
Post by: Candice on October 21, 2004, 05:12:18 PM
Helen, I'm not proposing another conspiracy.  I'm merely interested in seeing the table and resulting positions of the analysis. Just curious.

Candice





Quote

Candice, it doesn't matter if this mtDNA was totally different or only a little different, it didn't match to Charlotte's (Queen Victoria's granddaughter and Feodora's mother),  nor to Prince Philip's, which means that the remains in this grave were not those of a maternal descendant of Queen Victoria.... Are you trying to figure out whose DNA it did match?  Please PLEASE don't propose another conspiracy theory!  ::)

Helen

Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 21, 2004, 05:12:42 PM
Quote from: helen_azar References

 
[b
. A. Summers, T. Mangold, The File on The Tsar (Gollancz, London, 1976). [/b]


OHHHGawwwd

Now I know this will be a very odd scientific report!

I'd laugh, but I ought to cry.
rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 21, 2004, 05:32:11 PM
Quote
Helen, I'm not proposing another conspiracy.  Candice
Whew!  ;D

Candice, you do realize that this sequence will just be a very long string of four letters in various combinations? Like thousands and thousands of them? It's really not all that interesting to see. The comparison is done by computers not humans, and I doubt you would find looking at it too fascinating or too useful. I am not sure where you can find it, because I doubt someone would post a sequence on some website somewhere.... although stranger things have been posted. You may want to find out if a full sequence was published in some journal.

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 21, 2004, 07:01:35 PM
Much of what Alec Knight, et al, is saying in his rebuttal letter has already been addressed here on this thread. To a layperson some of these may sound like legitimate and convincing arguments, but they are not: what he is saying is misleading and he presents a lot of selective half-truths. . I will call him on it right here:

First example:

Dr Knight, you claim in your rebuttal letter that  "...the mtDNA of another relative, Princess Feodora, was found to have a C at position 16111, whereas her mother Princess Charlotte had a T at that position (15). ".

What exactly does this prove, Dr Knight? Only that the DNA thought to be Feodora's did not match the DNA thought to be her mother's. You neglect to mention that Charlotte's mtDNA exactly matched to that of Prince Philip which means it also matched to that of the bones believed to be Alexandra's and her daughters' as well as to some other matrilineal Victorian descendants, among whom was, as someone mentioned before, the Princess of Yugoslavia. It was the mtDNA assumed to be Feodora's that did not match to the rest of theirs, hence conclusions by the author of the book you cited were that the remains believed to be Feodora's were actually someone else's and not Feodora's. It was not the other way around, Dr Knight, as you would have us believe. I quote:

"As expected, Princess Charlotte and the Duke of Edinburgh are identical, whereas the DNA extracted from the bones recovered from Princess Feodora's grave gave a different result"
(J. C. G. Röhl, M. Warren, D. Hunt, Purple Secret: Genes, "Madness" and the Royal Houses of Europe. p.263 (Bantam, London, 1998.). (The emphasis is mine).

So why doesn't your "finger" match Philip's, and other Victorian mtDNA? Did it match the DNA of the bones they pulled out of Feodora's grave then? I doubt that, otherwise you would be shouting it from the roof. Have you done any other comparison DNA tests on this finger, other than the one that didn't match to Philip and others? Whose finger is this, Dr Knight?

The author of the book you yourself cited in your letter to the editor of Science accepts Philip's DNA sequence as legitimate. You have brought up the DNA mismatch discussed in this book just to cloud the real issues, probably hoping that no one reading your letter read this book.

Second example:

"There are many shallow mass graves in the Ekaterinburg region, including entire families that resemble the remains in question (7-10). The grave had been opened many times over the decades with many bones removed and added (1, 8-10)."

Yes, there may be many shallow graves with families in them in that area, but how many can be shown, via mtDNA analysis, not to mention other multidisciplinary evaluations, to have descended from Queen Victoria or to be related to the brother of Nicholas II? (please refer to my "Fourth example" if you wish to argue this point). You know exactly what I am talking about here, Dr Knight.

Third example:

Yes, it would be nice if someone else did an experiment using bones that were exposed to the same conditions as the Ekaterinburg bones, but you and I both know that due to unpredictabe nature of biology, this wouldn't prove or disprove anything. You are saying this just to cloud the issue.

Fourth example:

I will not even go into the PCR product argument here, for that would be useless, but I am sure that you are aware that this too can be explained without any contamination/conspiracy theories involved. And speaking of which, why don't you explain to us how it would be possible to get conclusive DNA results Dr Gill got, if contamination occured? Or else, explain to us how someone could have planted four different tissue samples of four different females descended from Queen Victoria, one of whom is a mother and three of whom are her biological children and are also the biological children of the Tsar? If you can explain that to us, logically and realistically, I will accept all your contentions. You have not explained anything to date, and your new paper that was supposed to be published "very soon" and "explain everything", is nowhere to be seen.  

And what exactly do you mean by "independent tests?" I still don't really understand what meets your criteria for those, if anything. Your friend, "JonC", tried to explain this concept to us, but he was not successful.

And why must you back up your statements with a slew of books that are a lot closer to a beach read than to scholarly publications? The shameful part is that even with those, you had to manipulate what the authors were saying.

Shame on you, Dr Knight for twisting the authors' words and manipulating scientific, and other, facts for your own purposes! "Junk" science, indeed.

Helen

Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 21, 2004, 09:42:20 PM
Helen

Bellisima!
I  do hope that you would be willing to present this entirely rational and cogent responce in a magazine (Nature Genetics perhaps ?) or in some other environment where collegues of Dr. Knight might see it --simply because I wonder if a lot of such experts are that familiar with this site!

Thank you so very much!
r.
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 22, 2004, 12:13:27 AM
Helen thanks very much for posting the Science letters!  ;D
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 22, 2004, 02:04:18 AM
Quote
. A. Summers, T. Mangold, The File on The Tsar (Gollancz, London, 1976). [/b]


OHHHGawwwd

Now I know this will be a very odd scientific report!

I'd laugh, but I ought to cry.
rskkiya



Equally, the inclusion of Gray's trashy novel Blood Relative falls into the same category! :o

I have already started to weep .... tears of fustration! :'(

Title: Re: New study questions identity of Romanov bones
Post by: Candice on October 22, 2004, 01:45:01 PM
Rskkiya and Helen, thank you for your reply.  I would find the sequence very interesting.  I know some people might find it boring but I don't.  

Candice
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 22, 2004, 06:59:44 PM
Candice?

  Sorry-- what are you talking about ? I had been posting a note to Helen --you must have been confused...
  I really cannot give you any information regarding the DNA strands.
Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 22, 2004, 07:10:13 PM
Candice
You actually want to see the actual sequences of the DNA? What sort of biology background do you have? to just "read the sequence" makes no sense.
The sequences would be hundred of lines of "attatcggccgtaatatcgccggctattaaacggg" etc. It takes special knowledge and computer programs to READ what that all means...
here is an actual sequence (tho not from the Gill study) see what you make of it:
1  GTTAACTACG TCAGGTGGCA CTTTTCGGGG AAATGTGCGC GGAACCCCTA

     51  TTTGTTTATT TTTCTAAATA CATTCAAATA TGTATCCGCT CATGAGACAA

    101  TAACCCTGAT AAATGCTTCA ATAATATTGA AAAAGGAAGA GTATGAGTAT

    151  TCAACATTTC CGTGTCGCCC TTATTCCCTT TTTTGCGGCA TTTTGCCTTC

    201  CTGTTTTTGC TCACCCAGAA ACGCTGGTGA AAGTAAAAGA TGCTGAAGAT

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 22, 2004, 10:10:14 PM
Quote
Helen

Bellisima!
I  do hope that you would be willing to present this entirely rational and cogent responce in a magazine (Nature Genetics perhaps ?) or in some other environment where collegues of Dr. Knight might see it --simply because I wonder if a lot of such experts are that familiar with this site!

Thank you so very much!
r.


You're welcome, rskkiya. I hope this clarified some things for people. Not to worry, I have a feeling this post will somehow find it's mark  ;).

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 22, 2004, 10:21:14 PM
Dave,

Did you get the chance to email Annals to confirm about Zhivotovsky? I emailed them today but so far didn't hear anything. I am pretty sure he is the LA Zhivotovsky....

Helen
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 22, 2004, 11:07:30 PM
Hello, it appears much has happened since I've not been on. Sorry, but I had more important things to attend to( no slight intended).

Ok! I see I've made DaveK quite incensed with the 'you lied' remark...nothing personal since you are using a pseudonym as we all are on this site...so chill out dude.

No, I'm not a scientist nor have I professed to be one but you Dave must be one hell of a scientist or just a dilitant or maybe Helen's hired gun/ closet scientist... I'm sure you will tell us all or be revealed soon enough. In any case welcome to the fray.

Since I've been away may I start with your post below which seemed to have gotten me in trouble.

You said:

Quote
Wait a minute.
I just recognized that there was no way that the bone was covered with fresh blood of Prince Philip.  
Dr. Gill did two tests.
1)      mtDNA matched with Prince philip’s mtDNA.
2)      Nuclear DNA’s karyotype was XX (female) , not XY (male).

If it’s Prince Philip’s fresh blood, it should show a XY (male) type.
What do you think JonC?  


From the above post I thought you had misunderstood as to how the STR study of the x-y amelogenin gene was infact performed and why. So I proceeded to instruct you that the Nuclear STR testing of the gene was to show paternity within the group. Infact we all have read from the original article that a certain number of female and male individuals were identified as belonging to a particular family because of the said testing.

To my surprise ::) you do know something about the Nuclear testing. Now, if you don't mind, could you please explain what you indicated above to be Dr. Gill's second test where the' Nuclear karyotype (xx) was  female and not (xy) male' ?

How does this figure in determining that the blood sample came from a woman, as you atest and not from a male.i.e. Prince Phillip?
I'm asking because I don't know the point you are making since I'm not a scientist/geneticist as you have pointed out quite eloquently.

Finally, I would like to say that it doesn't really matter what I believe or you believe to be the facts concerning the Romanovs and their disappearance since we are all stuck with the original paramiters of the problem conveniently provided to us by the Russians, like lab rats in a cage.
Title: Re: New study questions identity of Romanov bones
Post by: Alexandra on October 23, 2004, 12:05:39 AM
Hello to you all,

Having read this thread rather closely, I must ask some questions pertaining to the fitness of Lev. A. Zhirotovsky to participate on a project of human DNA identification.  I looked at his web page [link provided in an above post], and there learned that he has a Ph.D. in mathematics, but only a year of soi-disant Special Courses in Genetic, U. of Moscow, 1970-1. This preparation seems scanty indeed for him then to have assumed the polsition of Head of the Center for Human DNA Identification, Institute of General Genetics, Russian Academy ofSciences, 1997 on. His publications, moreover, strike me as having to do with plant and animal ecology and breeding, and with fruitflies.
How do these contributions - or are there others of which I have not heard - render him suitable to further research of the sort on which this thread focusses?

best wishes,

Katherine Alexandra M. Hines
Title: Re: New study questions identity of Romanov bones
Post by: Alexandra on October 23, 2004, 12:14:20 AM
In JonC's post above, she or he comments about

'...using a pseudonym as we all are on this site...so chill out, dude.'

Leaving aside the question of the dubious taste of including a street expression in a post to a site whose tone is consistently somewhat higher, we do not all use pseudonyms, and what has their use or non-use to do with the matters under discussion in this thread?

Katherine Alexandra M. Hines
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 23, 2004, 07:46:16 AM
Quote
In JonC's post above, she or he comments about '...using a pseudonym as we all are on this site...so chill out, dude.' Leaving aside the question of the dubious taste of including a street expression in a post to a site whose tone is consistently somewhat higher, we do not all use pseudonyms, and what has their use or non-use to do with the matters under discussion in this thread? Katherine Alexandra M. Hines


Dear Alexandra,

Perhaps you noticed that throughout this thread, whenever JonC is unable to address specific challenges presented to him (which seems to be quite often), he tends to attempt to shift the focus of the discussion to other things, to confuse the issue. He is not very skilled at it, but he tries nevertheless. Obviously this is what that last post of his is all about....
About your observations in reference to Lev Zhivotovsky: at the very least, the fact that he is on the review board of a journal that keeps publishing his and his colleague's dubious work is highly unethical, but I am not sure if there are any rules against it. Perhaps there are, and this is why the journal is trying to keep this under wraps, hence the "accidental-on-purpose" typo of his last name... I don't know much about this, so I don't want to speculate or make accusations, I just know that the journal has not answered our two inquiries about clarifying that as of right now...  
Title: Re: New study questions identity of Romanov bones
Post by: IlyaBorisovich on October 23, 2004, 08:14:38 AM
JonC,

If you read back through the thread, you'll find that when DaveK first started posting, he was unknown to both Helen and Dashkova and therefore could not be a "hired gun."  I thought I'd point this out, as Helen seems to be at the center of this monumental conspiracy you're convinced is being mounted against Dr. Knight and co.

In fact, when DaveK first posted you embraced him as a "man of character," (October 15th, 7:04PM) because, I think, you thought he agreed with your contamination theory.  Now he seems to have joined the other side.  Interesting.

Also, in your absence, it's been shown on this thread that contamination by Prince Philip's blood was impossible, as the Gill results were obtained before the Prince's blood sample was.  Unless you'd like to propose time travel as part of the conspiracy.  Say, could it have been the Master?  Better call in the Doctor!  A little tip of the hat to our favorite Gallifreyan Time Lord.  It makes as much sense as the other theories bouncing around these pages.

Ilya
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 23, 2004, 10:39:59 AM
Quote
JonC,

If you read back through the thread, you'll find that when DaveK first started posting, he was unknown to both Helen and Dashkova and therefore could not be a "hired gun."  I thought I'd point this out, as Helen seems to be at the center of this monumental conspiracy you're convinced is being mounted against Dr. Knight and co.

In fact, when DaveK first posted you embraced him as a "man of character," (October 15th, 7:04PM) because, I think, you thought he agreed with your contamination theory.  Now he seems to have joined the other side.  Interesting.

Also, in your absence, it's been shown on this thread that contamination by Prince Philip's blood was impossible, as the Gill results were obtained before the Prince's blood sample was.  Unless you'd like to propose time travel as part of the conspriacy.  Say, could it have been the Master?  Better call in the Doctor!  A little tip of the hat to our favorite Gallifreyan Time Lord.  It makes as much sense as the other theories bouncing around these pages.

Ilya


Dear Ilya,

As you will soon find out, if you haven't already, JonC is impossible to reason with. This is why I wasn't even going to acknowledge his now upteenth conspiracy theory of a "hired-gun scientist"  ::).  What?? ;D Oh boy. But "hired-gun" or no, facts are facts, and they were presented here indisputably. Unfortunately, JonC refuses to accept them because they don't seem to fit into his and his friends' agenda. Very sad, in fact. I feel kind of sorry for him in an odd way.  :(

Helen


Title: Re: New study questions identity of Romanov bones
Post by: Candice on October 23, 2004, 03:03:10 PM
FA, thank you for your example.  Like many people I think science has become more interesting in the last thirty years.

My reason for wanting to see the table is that Prince Philip's DNA was published in Nature genetics a few years back and I have a xerox copy.  It gives the Hypervariable Region 1 and Hypervarible Region 2. Both regions are identified by using numbers eg. in the first position of region 1, 16111 it lists a T and so on. Just curious on my part to see how all the other positions compared with Dr. Night's new Stanford analysis.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 23, 2004, 07:21:20 PM
Helen.

Have your 'hired gun' please answer my question. Also, I would ask you to be civil and listen to the admonition of the FA. Best Regards. JonC

PS Iliya.

For your info I don't have any kind of allegiance to Dr. Knight what-so-ever. I disagree with him representing his 'claimant'. I also don't think his claimant has a leg to stand on let alone a gene, lol ! ;D.

The only thing I do like is that his research has raised questions about the validity of all the 'proof' handed down to Dr. Gill by the Russians. I do think Dr. Gill and his team was duped with evidence which was grossly mishandled and exagerated to mean it belonged to the Royal Family from origin.
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 23, 2004, 08:53:32 PM
Quote
Helen.

Have your 'hired gun' please answer my question. Also, I would ask you to be civil and listen to the admonition of the FA. Best Regards. JonC
.


JonC --
  Could you please be equally civil both in tone and in requests?
  Helen, to the best of my knowledge has no "hired gun," but if you want to discuss something with "Davek" I feel certain that if you politely post a question he would -at his discression- try to answer you.
Ok?
rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: IlyaBorisovich on October 23, 2004, 10:05:15 PM
JonC,

If you don't mind my asking, who are you to demand anything of Helen, or anyone else on this board?  You won't even acknowledge the inconsistancies in your own posts, or that you might possibly be wrong about DaveK (as well as a great many other things).

Posting a demand like that then asking for civility shows a certain delusion about one's place in the cosmos as well as a fair amount of detachment from reality.  Do you wonder why no one takes you seriously, or have you not even noticed it?  Oh, and BTW, it's ILYA, not Iliya.

Ilya
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 23, 2004, 11:05:06 PM
Quote
I do think Dr. Gill and his team was duped with evidence which was grossly mishandled and exagerated to mean it belonged to the Royal Family from origin.

The major problem with this statement is the unquestionable fact that Gill sequenced the remains BEFORE a sample was taken from Prince Philip. HOW can "mishandling" or "exaggeration" lead to the unquestionable result that it MATCHED Prince Philip's DNA to a certainty of over 99.5 percent??
Title: Re: New study questions identity of Romanov bones
Post by: Valmont on October 23, 2004, 11:37:50 PM
JonC..
Beat that !!..
I would love to hear your explanation of this event..
Title: Re: New study questions identity of Romanov bones
Post by: IlyaBorisovich on October 23, 2004, 11:51:02 PM
*Heavy sigh*

This is like planting petunias at the South Pole, a total waste of our time.  Perhaps if we just all told JonC he was right, that we're ALL involved with the grand conspiracy, he'll take his crown of rightness and just go away?  It's worth more of a shot that reasoning with him.

Ilya
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 24, 2004, 12:24:50 AM
Quote
I do think Dr. Gill and his team was duped with evidence which was grossly mishandled and exagerated to mean it belonged to the Royal Family from origin.


JonC,

Respectfully, as a professional medical scientist I am appalled by your inference. If you have any credible documented evidence which clearly indicates duplicity, please be kind enough to present this evidence. Otherwise may I suggest you chose your words more carefully.

Dr Peter is a professional who with Sir Dr Alec Jeffreys pioneered forensic DNA profiling in 1986.

May I suggest you try and find a copy of Hidden Evidence Forty true crimes and how forensic science helped solve them written by David Owen, 2000, Firefly Books.

This simple book clearly explains DNA profiling techniques. It is loaded with color images. A brief chapter is devoted to Dr Gill's analysis of the Romanov remains @ pp 214-7.

Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 24, 2004, 12:37:32 AM
Quote
*Heavy sigh*

This is like planting petunias at the South Pole, a total waste of our time.  Ilya


Hi Ilya,

Even petunias can be grown at the South Pole inside the A.T. bases, if they are handled with care and patience. Perhaps there is hope yet?

Defeat is not the best outcome! ::)
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 24, 2004, 01:47:53 AM
It seems that there are a few scientists like Alec Knight.....

A few weeks ago, a low impact journal called Proceedings of the Biological Society of Washington has published a paper that argues in favour of intelligent design , a theory that rejects evolution— the first time such material has appeared in a peer-reviewed publication. The paper is available at http://www.discovery.org/scripts/viewDB/index.php?command=view&id=2177&program=CSC%20-%20Scientific%20Research%20and%20Scholarship%20-%20Science

The “The Scientist” concluded that Editor in Chief, Richard Sternberg, was a creationist. http://www.geocities.com/lclane2/pbsw.html

Nature took a note as to this affair. From this week issue, one reader's letter:

The editors and reviewers of many low-impact journals cannot provide the quality reviewing process one gets with Nature, Science, Cell and a few (very few indeed) other established magazines, but any of them can affix the stamp of legitimacy to their outpourings by formally following the 'peer-review' protocol.

Let's admit it — and this is the real dirty secret of academic publishing — one can publish just about anything if one goes far enough down the list of impact factors. There are papers all around us containing problems glaring enough to fail their authors in undergraduate midterm exams.




Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 24, 2004, 02:09:10 AM
Quote
The original shill on this Board for the Knight report, "Rodger", freaked out when I told him that private testing had been conducted on Princess Katherine of Yugoslavia, a maternal line Victorian descendant, BEFORE a sample was requested from Prince Philip. These tests were conducted in the United States and their results were completely unknown until a few years ago.


Dear LisaDavidson, thanks for your info.
by any chance, do you know if this result was published? I can't even find information of Katherine of Yugoslavia. This site lists Queen Victoria's Descendants,  (Andrej of Yugoslavia, Tomislav of Yugoslavia, Andrej of Yugoslavia), but not Princess. Is this wrong? http://www.btinternet.com/~allan_raymond/QV_Intermarriages.htm.
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 24, 2004, 02:44:35 AM
Quote
It seems that there are a few scientists like Alec Knight.....


Let's admit it — and this is the real dirty secret of academic publishing — one can publish just about anything if one goes far enough down the list of impact factors. There are papers all around us containing problems glaring enough to fail their authors in undergraduate midterm exams.


Hi DaveK,

Unfortunately, despite the impact factor of journals, all authors have made their impact in the global arena, regardless of where their work was published.

Publicity and to be cited is exactly what some authors seek.

To claim that X number of papers have been published by a particular scientist adds to their self esteem and can influence external funding for their pet projects. ;)

Accordingly, the number of citations have a strong bearing as well.
Title: Re: New study questions identity of Romanov bones
Post by: Richard_Cullen on October 24, 2004, 03:21:55 AM
Interesting stuff this, although some of the debate interests me and some of the remarks seem rather disconnected with reality, but isn't that always the case?

I have asked Greg whether to his knowledge the meadow has been examined from the air, there is some excellent technology that has been refined over the years and is used on the BBC 2 Programme Time Team to identify graves, buildings etc.

I am pretty chilled about the DNA - and am concerned that someone should suggest a conspiracy theory to pervert the scientific evidence.  I think in a fanciful world we would accept some of the monarchist investigations.  The reality is that the bodies were found (minus two) in the grave, in the meadow.

Unfortunately when politics, religion and emotions get involved in investigations and the view taken of evidence it clouds views.  I have found that to be so in the Rasputin re-investigation and it is obvious there are even larger doses of it in the 'bones' issue.

Would be great to know all the 'unknowns' but we don't.  The changing stories of those involved and fabricatuions of both the Whites investigators and all the years of communism have shrouded much of this not just in a mist but a pea souper of a fog.

It would be great to be able to re-investigate it all, with access to all the witnesses - live.  But as in Rasputin it strikes me that there is a tissue of lies all yuo do is replace the names of the main players in Rasputin; Yusupov; Purishkevich; Lazovert and replace them with the actors at the scene of the regicide and the subsequent undled disposal of the bodies.

Richard
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 24, 2004, 11:21:00 AM
The results were never published because the tests were done to see if a well healed claimant's mtDNA matched the Victorian maternal line. It did not.

The reason the site does not mention Katherine is that it's one that deals with QV descendants who married one another. Katherine married a commoner.

Katherine's matrilineal descent from QV:

Victoria R - Alice of Hesse - Victoria Milford Haven - Alice of Greece - Margarita of Baden - Katherine of Yugoslavia, Mrs. Desmond DeSiliva

If I left out a link, sorry, am rushing to go out today.
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 24, 2004, 05:00:05 PM
To anyone who still believes in conspiracy theory:
----Why I had to abandon the conspiracy theory-----

Does everybody know "Moon-landing hoax" conspiracy theory? Fox aired a program called "Conspiracy Theory: Did We Land on the Moon?" It is the most well-concocted one. Even I almost fell for it. Motivation (to win the cold war) was clear and there are lots of evidences (a footage that shows the US flags on the moon was fluttering in the wind!) and there was a witness (one of astronauts admitted they shot the footage on the earth!). Compared to the Moon conspiracy, this Romanov bone conspiracy is so pathetic. It's even less plausible than "6000 Jews didn't go to WTC on 911!" conspiracy.

I considered all possibilities, because I wanted Romanov bone mystery alive. FA maintains Gill asked Prince Philip after they sequenced bones, but what if they obtained a hair sample by sneaking into the Palace? Is it physically possible that some super-secret organization achieve faking all the results without letting scientists notice? YES. The problem is that such an organization requires astronomical budget and man powers.

It costs a lot, because as I explained before, this deception cannot be achieved by simply swapping the samples (unlike AA case). It is impossible to concoct DNA strand itself because no one knew what DNA markers Gill was going to choose among hundreds of markers in advance. Only way is “data-swapping”.  However, outwitting Gill’s team alone would require a dozen Misson Impossible’s Tom Cruise-level agents backed up by a team of 300 top-quality scientists. You have to multiply this number, because they did independent study in other labs and every year new scientists in multiple countries get new samples and compares them each other.

The most difficult part is the heteroplasmypart, because Gill was dealing with something unknown to many scientists in 1994. To fake that, you needed to know genetics knowledge 5 years ahead of all geneticists and Human Genome Project in 1994. According to some big pharmaceutical corps’ think tank, it would require at least $50 bllion annual budget to do that,  almost twice as big  as NIH budget. And the whole project had to start since 80’s, before you knew the debacle of Soviet Union or the end of cold war.

I also considered the possibility to bribe all scientists to shut their mouths, but that would cost even more and preventing whistle blower would be difficult. Considering you can buy the Russian Presidential election for less than $200 millions, or all members of Russian congress member for less than $20 billions, it would be much easier to buy them instead of spending $500 billion for 10 years of faking a sequence of a few bones! Besides, if you have $500 billions, what's the point of becoming a constitutional monarch of the country whose GDP/capita is $5000? Or maybe buying all Russian people would be cheaper. Giving all citizens $3000 tax credit (half the annual income) would easily turn public opinion to support constitutional monarchy, which is not that unpopular idea from beginning.

Only another plausible way is the alien link. I heard  that there were as many as two crop circles in 1994  in Solihull UK near the Forensic Science Service where Gill works. I am currently investigating this matter. ;D

I welcome any plausible alternative scenario.
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 24, 2004, 05:01:23 PM
Quote
The results were never published because the tests were done to see if a well healed claimant's mtDNA matched the Victorian maternal line. It did not.

.



Thanks a lot!
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 24, 2004, 05:57:44 PM
Hi everyone. I have an interesting bit of news. I just got back from the Newark museum where the Nicholas and Alexandra exhibit currently is showing, and today th author Robert Massie was giving a lecture. Afterwards they had a little reception for him, so I got to talk to him for a few minutes. Since he is cited in the Knight paper at least three times, of course I wanted to ask him what his take on this whole Knight thing was. So I asked him about it. He knew exactly what I was talking about right away, and after I mentioned it, he very adamantly said "They are wrong!". So, looks like another author Dr Knight quoted in his paper and his rebuttal letter has been misquoted, or rather his meaning has been twisted. Not surprising, considering the track record and what we have seen so far, but still this just doesn't cease to amaze me, how far will this guy go?  :-/

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Merrique on October 24, 2004, 06:34:34 PM
Obviously this guy will go very far to try and make the world believe his "theory".This whole thing has become extremely sad and ridiculous.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 24, 2004, 07:08:11 PM
Helen.

I also went to the lecture...boy! if I only knew you were there I would have introduced myself and then? Who knows?

I particularly disliked the way he was negative on any new material or info. When asked if he would update his book he said no he wouldn't. He's sold 15 million copies of the original 'Nicholas & Alexandra' so what does he care. His next book was going to be on 'Catherine the Great.'

I was not impressed by his presentation. When asked about Greg King's new book as it compared with his N&A, he shut down the conversation by saying he has never read King's book. I heard some groans in the audience about his response.
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 24, 2004, 07:31:51 PM
Quote
The major problem with this statement is the unquestionable fact that Gill sequenced the remains BEFORE a sample was taken from Prince Philip. HOW can "mishandling" or "exaggeration" lead to the unquestionable result that it MATCHED Prince Philip's DNA to a certainty of over 99.5 percent??



FA, you must understand that when I say ' from origin' I don't mean from Gill's lab at Aldemaston, England. I mean from the Koptiaky forest, Russia.

In other words how do we know if the BONES belonged to Nicholas and his immediate family? The grave was openned and closed several times. Skulls were taken and subsequently replaced after some time. Nicholas's skull, I read somewhere was even taken to Paris, France by I think Sokolov who had it under his bed for a while.

For all we know the bones could be of relatives of the Royal Family because the gravesite was never preserved.

When Dr. Gill accepted the 'bones' why didn't he ask for proof that the samples had kept their integrity?

Why did he simply take the word of the Russian representatives that anthropological studies performed on the bones indicated they belonged to Nicholas and his family? Did he ask to see the studies?

As Dr. Knight pointed out each skull had huge chunks missing from the frontal sections. I don't see how a positive identification could have been made on any of them.

Dr. Gill performing his studies before acquiring Prince Phillip's sample doesn't really mean anything in light of the above problem.
Title: Re: New study questions identity of Romanov bones
Post by: Forum Admin on October 24, 2004, 07:48:39 PM
Quote

In other words how do we know if the BONES belonged to Nicholas and his immediate family? For all we know the bones could be of relatives of the Royal Family because the gravesite was never preserved.

umm, I got your point. YOU fail to understand the simple logistics of what you suggest, and fail to show a genuine motive to do what you suggest.

FIRST, they would have had to find Romanov relations that are of the exact age and gender of the IF. THEN, those all dead female relations would ALSO have to have a maternal relation to Queen Victoria and a mother/daughter relation with the elder female. We can stop right there, because there ARE no dead relations that fit that bill. THEN, the male relation HAS to be a fraternal relation to GD George Alexandrovich...all those candidates are accounted for OTHER than Nicholas....

we don't even need to bother with WHY the russians would try to do this,since there is NO possible candidate of dead Romanov's whose dna could match...

Before I let you continue with this claim, I insist you provide a LIST of the POSSIBLE dead Romanovs whose remains COULD have been substitued...please.

Read some history, then some science. You seem to need more info on both counts
Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 24, 2004, 08:17:24 PM
Regarding the updating of books: in this internet age, I think many of us assume that writers and publishers are up for this. It's simply not usually the case. Many of us would like Peter Kurth to update "Anastasia" and he is willing - but his publisher is not and if I recall correctly, the publisher owns the rights for any subsequent editions.
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 24, 2004, 08:32:47 PM
Lisa,

I think the exact question directed at Massie was: "Considering that currently there so much more access to so many different archives that weren't available at the time you wrote N & A (in the 60's), would you now write something different or add anything new to what you had written then?" He answered that he wouldn't change anything at all, that he would keep it exactly the same. I also thought that sounded a little odd, surely there must be at least some new information that came to light that he would want to add. I don't think he meant it as in "the editor wouldn't let me", he meant it as in "this would be my own choice"...
I was wondering, do you know what Peter Kurth would change if he would update "Anastasia"? He hasn't changed his mind about her yet, has he?

Helen

Quote
Regarding the updating of books: in this internet age, I think many of us assume that writers and publishers are up for this. It's simply not usually the case. Many of us would like Peter Kurth to update "Anastasia" and he is willing - but his publisher is not and if I recall correctly, the publisher owns the rights for any subsequent editions.

Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 24, 2004, 09:10:18 PM
Quote
Hi  very adamantly said "They are wrong!". So, looks like another author Dr Knight quoted in his paper and his rebuttal letter has been

Helen


helen, thanks for your info. It seems that there is not a single author or scientist who supports Knight study except Knight group.  Annals of Human Biology is controled by Knight Group itself and Roger was indeed Litwin. That kind of sucks  :(, as I am still open-minded to any alternative scenario...
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 24, 2004, 10:05:53 PM
That may not be exactly true, there are a couple of scientists seem sort of open to this, but I have a feeling they don't know the full story and just take his information at face value...

Quote
It seems that there is not a single author or scientist who supports Knight study except Knight group.  

Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 24, 2004, 10:28:49 PM
Quote
Lisa,

I think the exact question directed at Massie was: "Considering that currently there so much more access to so many different archives that weren't available at the time you wrote N & A (in the 60's), would you now write something different or add anything new to what you had written then?" He answered that he wouldn't change anything at all, that he would keep it exactly the same. I also thought that sounded a little odd, surely there must be at least some new information that came to light that he would want to add. I don't think he meant it as in "the editor wouldn't let me", he meant it as in "this would be my own choice"...
I was wondering, do you know what Peter Kurth would change if he would update "Anastasia"? He hasn't changed his mind about her yet, has he?

Helen



AFAIK, Kurth remains devoted to AA's memory and rejects claims that she was Franziska Schanzkowska. I believe he has said he would be willing to update his book, but that the publisher owns the rights to this. Since PK is great about speaking up for himself, any inaccuracies in my memory can be corrected by him.

I am sorry that Massie is not interested in updating Nicholas and Alexandra. It is by far his best book. Perhaps since ex-wife Suzanne was such a big part of that book, it is not comfortable for him to revisit that work?
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 25, 2004, 08:46:41 PM
Apparently Annals of Human Biology just fixed their typo, the name now reads" LA Zhivotovsky  ;) :D
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 25, 2004, 08:52:12 PM
Awwww...how cute...at least *one* of the Knight team still lurks here, when they're not posing as someone else (not difficult to guess which one, either, the one who has time but no knowledge)
LOL.
Thanks Helen, as always for your very informative posts.
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 25, 2004, 09:27:51 PM
----MY SUSPICION: Did Knight hide the failed PCR?--------

When I was looking at the Table in the Knight's study (below), I noticed something bizzare.

------------------FROM KNIGHT's PAPER Table 2------------------
 


PCR Product       No. of clones haplotype
E3 8 16327T, 16357T
2 16327C, 16357T
------------------------------------------------------------------------------

It is a common custom among geneticist to present the sequence alignment like the way below. But he showed unnecessarily confusing format (above). Why did he used an odd table to show his data, instead of using a regular format? (Besides, he used wrong nomenclature 16327C/16357T under the word "haplotype", which gives you a wrong impression that there are 2 SNPs (mutation) in the finger sample. It's like he used "04/12/03" to describe "March 12th, 2004").

When I converted his unusual table into a regular table format (see below) with P Gill's result, the reason is obvious.
------------------------------------------------------------------------------------------
 











Cambridge Reference Seq HVI*CTGCCCCCACCTTCT
Servant 1 +++++++++++C+++
Servant 2 ++++++++++++C++
Servant 3   ++++T++TG+++C++
Dr Botkin (putative) +++++T+++++++++
Romanov Daughter 1 T+++++++++++++C
Romanov Daughter 2 T+++++++++++++C
Romanov Daughter 3 T+++++++++++++C
Tsarina Alexandra T+++++++++++++C
Prince Philip T+++++++++++++C
Tzar Nicholas II +C+Y+++++TT++++
gg grandndson Loise Hesse C +C+Y+++++TT++++
[tr][td] [finger Knight claims Elizabeth]**  [/td] [td] +A+XXX+++++++T+[/td][/tr]
[tr][td] [contaminated DNA from finger] [/td] [td] T++XXX+++++++++[/td][/tr]

[/table]
(*15 positions in HVI are shown: 16111, 126, 129, 169, 261, 264, 266, 278, 293, 294, 296, 304, 311, 327, 357)
(** “X” indicateds the position where PCR was not performed.)
(“+” indicates no difference from Cambridge Reference)
------------------------------------------------------------------------------------------

Bring your attention to the symbol XXX in the Knight's sequences (bottom row). More than 100bps are MISSSING which is critical for the HVI comparison. Wouldn't it make sense to think that he didn't use regular format because he wanted to make the "hole" less conspicuous?

Hypervariable region I (HVI) covers about 350bp (mtDNA 16024-16365). He didn't sequence the 106bp middle region 16168-16273. Is it a big deal? YES. For any statistical analysis, you can't pick up your "favorite" region among HVI. Knight might argue that he chose these PCR regions only to check rare mutation 16111T and 16357C. But if he skipped one region on purpose, it indicates a fundamental flaw in his experiment design. He must not draw the conclusion before he begun the experiment, even if he "knew" that “Gill's result was a hoax”. What if DNA from the finger matches to Tsarina's? You must analyze the whole HVI. No reviewers accept this biased methodology which skew any conclusion.

In case you don't know a general PCR method for HVI region. You usually perform three short consective PCRs to cover 340bp region. Each PCR is around 110-120 bp. He did 1st PCR (60-168), and 3rd PCR (273-384). But he missed 2nd PCR between them. Because you need a 20bp overlapping region between 2 PCRs, the missing PCR part is around 126bp size. But why didn't he sequence this part?? It's odd because it doesn't add significant cost or time to do it (two PCR primers costs $16 + shipping).

When I read the method section carefully, this mystery was solved. Knight performed PCR of size 128bp, but it failed (weak signal not good enough for cloning). Knight didn't say that this PCR was for the middle part, but it is logical to think it is. What is disingenuous is that he made it sound like it failed because 128bp was longer than 110bp. This is ridiculous. 1000bp failed because of its size, but 128bp and 110bp are practically the same size.

This failure is critical for the study, because few lab has a problem with this short PCR from as young as 75 years old sample. Many labs are successful with longer 200bp PCR from as old as 3000 years old sample. If they can't perform short 128bp PCR, it indicates that there is something wrong with his method or sample. Either the method was sub-optimized (Appendix 1*) or the sample was extremely degraded. Knight used a odd table to dodge the question to this point,because either reason severly undermine his claim "long PCR product is impossible". if people knew this, they would tell you "Yeah, because your lab messed up PCR!"

I have to emphasize that even if Knight did 2nd PCR in a correct way, his claims cannot be substantiated by his data. Even if he is able to establish the difficulty of long PCR, he still doesn't provide alternative scenario to explain the match between Philip and Romanov DNA. What I wanted pointed out is that his claim is so wrong  in multi-layered way, both in logical and technical ways.    

I may be alienating people by too technical materials. But if anyone is interested in, I reveal another stuff next time.

P.S. Come to think of it, there is no way that Knight skipped 2nd PCR on purpose. Knight still believes that Finger's DNA is the FIRST TRUE ROMANOV DNA. Then he must want to show the whole sequence for the first time to leave his name in history!


---------Appendix 1: Some technical flaws in Knight paper--------------------
There are significant difference between ancient DNA method and fresh DNA method. Knight doesn’t seem to know this. To my knowledge, none of Knight Group including both Stanford and Los Alamos has an experience in ancient DNA. They should have asked the lab who does it, but they didn’t. Unfortunately, they simply applied a method for a fresh DNA, which results in a grossly un-optimized condition for ancient DNA.
1) Ancient DNA samples are usually powdered by grinder with liquid nitrogen to maximize the yield. But Knight just soaked it in proteinase solution.
2) Ancient DNA should be concentrated by Centricon devices during purification. Knight used only ethanol method, which is known to produce low yield DNA and  high impurities which prohibit PCR reaction.
3) PCR should be done with either consecutive two PCR or nested PCR. Knight used Touch-down PCR for unknown reason. (Touch-down PCR is usually used for degenerative PCR or unknown primers.)
4) Knight failed to use an appropriate positve DNA control. He should have used mock-extracted DNA as control and should have done competitive PCR to monitor DNA yield.
5) Finally, the most bizzare part is that Knight didn't repeat P Gill's method, although the reproducing his PCR was the whole point of the study. His protocol was completely different from Gill’s.
Title: Re: New study questions identity of Romanov bones
Post by: RichC on October 25, 2004, 10:11:05 PM
Quote
I am sorry that Massie is not interested in updating Nicholas and Alexandra. It is by far his best book. Perhaps since ex-wife Suzanne was such a big part of that book, it is not comfortable for him to revisit that work?



I disagree that Nicholas and Alexandra is by far Massie's best book.  Peter the Great was also a beautifully written story and it won Mr. Massie a Pulitzer Prize in 1980, I believe.  I attended a book signing when Massie published The Final Chapter and he told the group at that time that The Final Chapter would be his last book about N and A.  He said he was moving on to other interests.

I would not want to see Nicholas and Alexandra updated because it is so beautifully told as is.  It was Massie's great gift of storytelling that got me (and MANY other individuals) interested in the history of Russia in the first place.  Sure, recent scholarship has uncovered much new information about N and A but the real value of Nicholas and Alexandra is that Massie was able to bring Nicholas and Alexandra to life for many readers thus making history interesting; something few authors or history professors can do.  He has updated the forward and that seems to be enough.  

Title: Re: New study questions identity of Romanov bones
Post by: LisaDavidson on October 25, 2004, 10:18:50 PM
DaveK - I am reading all this and thank you for taking the time to explain all this.
Title: Re: New study questions identity of Romanov bones
Post by: Dashkova on October 25, 2004, 10:25:22 PM
RichC, I agree 100 percent with what you posted about Massie.  I think his Peter the Great is his greatest work, and that N&A is a perfect gem of a book exactly as it is.

And DaveK, I am so grateful for your posts.  I do not always understand the science, but between you and Helen everything is explained in terms I *can* and do understand.  Thank you very much for your efforts.
Title: Re: New study questions identity of Romanov bones
Post by: daveK on October 25, 2004, 11:37:12 PM
I added this comment to my previous posting.

P.S. Come to think of it, there is no way that Knight skipped 2nd PCR on purpose. Knight still believes that Finger's DNA is the FIRST TRUE ROMANOV DNA. Then he must want to show the whole sequence for the first time to leave his name in history!
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 26, 2004, 07:08:26 AM
DaveK,

Thank you for that very interesting post and evaluation!

Helen
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 26, 2004, 07:34:23 AM
Dave,

Besides, he used wrong nomenclature 16327C/16357T under the word "haplotype", which gives you a wrong impression that there are 2 SNPs (mutation) in the finger sample. It's like he used "04/12/03" to describe "March 12th, 2004").

Do you think this was deliberate or due to incompetency?

He must not draw the conclusion before he begun the experiment, even if he "knew" that “Gill's result was a hoax”. What if DNA from the finger matches to Tsarina's? You must analyze the whole HVI. No reviewers accept this biased methodology which skew any conclusion.

Of course he already drew the conclusions, that was obviously the whole of point of him doing this study. They were out to prove that these bones were not the bones, at any cost, and designed this whole study with that in mind! It was completely biased.

What is disingenuous is that he made it sound like it failed because 128bp was longer than 110bp. This is ridiculous. 1000bp failed because of its size, but 128bp and 110bp are practically the same size.

Many labs are successful with longer 200bp PCR from as old as 3000 years old sample. If they can't perform short 128bp PCR, it indicates that there is something wrong with his method or sample.

Knight used an odd table to dodge the question to this point,because either reason severly undermine his claim "long PCR product is impossible".


Seems like Dr Knight not only manipulated what historians and biographers were saying but also the science! But he did it in such subtle way, that it is not immediately obvious. Unbelievable.

i]I have to emphasize that even if Knight did 2nd PCR in a correct way, his claims cannot be substantiated by his data. Even if he is able to establish the difficulty of long PCR, he still doesn't provide alternative scenario to explain the match between Philip and Romanov DNA. What I wanted pointed out is that his claim is so wrong  in multi-layered way, both in logical and technical ways. [/i]

The question is, where were the peer reviewers? How did they let this pass? Isn't that the whole point of peer review? Oh yes, I forgot, they are the friends of the co-author....

Then he must want to show the whole sequence for the first time to leave his name in history!

Perhaps this is what this is all about for Dr Knight? He wasn't out to show facts, just to make a name for himself? I think this wil backfire instead....

There are significant difference between ancient DNA method and fresh DNA method. Knight doesn’t seem to know this. To my knowledge, none of Knight Group including both Stanford and Los Alamos has an experience in ancient DNA. They should have asked the lab who does it, but they didn’t.

Unfortunately, they simply applied a method for a fresh DNA, which results in a grossly un-optimized condition for ancient DNA.

5) Finally, the most bizzare part is that Knight didn't repeat P Gill's method, although the reproducing his PCR was the whole point of the study. His protocol was completely different from Gill’s.


Then how can he claim to have replicated Gill's study??

Seems like he makes so many unsubstantiated or downright wrong claims... even more than we first suspected. I just can't believe this guy is getting away with all this!

Helen

Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 26, 2004, 10:50:04 AM
Quote

 Sure, recent scholarship has uncovered much new information about N and A but the real value of Nicholas and Alexandra is that Massie was able to bring Nicholas and Alexandra to life for many readers thus making history interesting; something few authors or history professors can do.  



I think that this is what Massie meant when he said he didn't want to change anything about "N & A"...

I also like his "Peter the Great" very much, in fact I got my copy signed by him on Sunday  :)
Title: Re: New study questions identity of Romanov bones
Post by: Candice on October 26, 2004, 05:04:38 PM
DaveK, thank you very much for the information.

The finger that Knight claims Elizabeth wasn't that DNA compared with Alexandra's and wasn't that thought to have belonged to her friend Barbara?

Will they be performing a new DNA analysis on the body in Jerusalem?

Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 26, 2004, 09:10:50 PM
Quote
Will they be performing a new DNA analysis on the body in Jerusalem?


We can be optimistic, but I believe we might be waiting for a while! ;)
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on October 26, 2004, 09:44:43 PM
Quote
The question is, where were the peer reviewers? How did they let this pass? Isn't that the whole point of peer review? Oh yes, I forgot, they are the friends of the co-author....


Of course the joy of not having one's article peer reviewed is that it enables publication of results which otherwise would be subject to scrutiny. How very convenient for all concerned!  ;)
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on October 26, 2004, 09:59:18 PM
I think Massie's FINAL CHAPTER could be safely considered an update of N&A.
And DaveK, thank you for putting the dna material so clearly, that those of us not even remotely cogent about such matters could understand. I appreciate that illustrative post immensely. I actually UNDERSTOOD what you were talking about !!
Cheers & CARRY ON !
Robert
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 27, 2004, 08:39:51 AM
Quote
Will they be performing a new DNA analysis on the body in Jerusalem?


Candice,

I woud even go as far as saying: Don't hold your breath  ;)

Helen
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 29, 2004, 12:34:47 PM
Hello
Davek -Thanks again for all your clear and concise posts regarding all of this -- and I should like to apologize for some of JonC's less than charitable remarks.
Spasibah
Rskkiya
Title: Re: New study questions identity of Romanov bones
Post by: JonC on October 30, 2004, 12:21:58 PM
rskkiya you're my hero! ::)
Title: Re: New study questions identity of Romanov bones
Post by: rskkiya on October 30, 2004, 06:39:35 PM
JonC

  In all honesty (and from examining previous posts) I would guess that you and I are most likely on opposite sides of the political/historical spectrum-- however, if we can all remain CIVIL here--there will be no need to spend time apologizing.

OK?

Rskkiya

PS :  I am curious to read the published "evidence" although I am rather dreading the actual outcome.
R.
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on October 30, 2004, 06:56:42 PM
Same here. Has therte been any further word on WHEN the King report is due out?
Should be a lot of fun, to say the least.
Cheers,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on October 30, 2004, 07:01:04 PM
Quote
...the King report is due out?
Robert


Robert,

I think you  mean the "Knight" report? Not a peep from him as far as I know... Perhaps another case of not holding our breaths?  ;)
Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on October 30, 2004, 07:46:56 PM
Yes, quite right. I was getting a post off to king & forgot to change names. Thanks,
Robert
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on March 13, 2005, 07:47:14 PM
Hello everyone,

I am reviving this to let everyone who followed this thread know that I just posted an investigative article that I, and another forum member, Margarita Nelipa (aka "Belochka") collaborated on for the current issue of the Atlantis magazine.  We got Greg King's permission to post it here, to give anyone who does not subscribe to this magazine the opportunity to read the article. Thank you, Greg.

This article deals with the Stanford study which we "pick apart" and explain step by step, drawing our own conclusions. It also includes our interview with Drs Peter Gill and Erika Hagelberg, as well as a comment by the author Robert Massie, who was cited numerouos times in Alec Knight's paper.  

I've posted the article on the "DNA" thread, here is the link:

http://hydrogen.pallasweb.com/cgi-bin/yabb/YaBB.cgi?board=anastasia;action=display;num=1108948411;start=200#205

Thanks everyone for your participation in this discussion which inspired this article!  :)

Helen and Margarita (Belochka)  :)  :)

Title: Re: New study questions identity of Romanov bones
Post by: AGRBear on March 23, 2005, 02:23:55 PM
So, all of this discussion has been over a finger which was thought to be GD Elisabeth, the sister of Tsarina Alexandra.

The severed finger wasn't Elisabeth's, according to the DNA not matching Alexandra's.

Might it be her friend [Vera or Varvara, I think her name was, a nun] or  was the finger someone's who wasn't found in the pit?  Any other tests been made to identify the owner?

AGRBear

PS  I had to go over to the thread which had the list of shooters to remember who else was in the pit with Elisabeth and they were:
The list:
Grand Duchess Elisabeth Fedorovna
Grand Duke Konstantine's three sons:  Ioann, Konstantine and
          Igor
Prince Vladimir Pavelovich Paley
Grand Duke Sergi Mikhailovich
Nun - known as Barbara [ Varvara]
Title: Re: New study questions identity of Romanov bones
Post by: Helen_Azar on March 23, 2005, 11:01:34 PM
Quote
 
Might it be her friend [Vera or Varvara, I think her name was, a nun] or  was the finger someone's who wasn't found in the pit?  Any other tests been made to identify the owner?
 


Bear, if you read our article, you will have the answer to this question and some others you posed here.

Quote
So, all of this discussion has been over a finger which was thought to be GD Elisabeth, the sister of Tsarina Alexandra.

The severed finger wasn't Elisabeth's, according to the DNA not matching Alexandra's.
 


Actually the theory is that the finger cannot belong to Elizabeth not because it didn't match Alexandra's DNA, but because it didn't match Prince Philip's DNA.
Title: Re: New study questions identity of Romanov bones
Post by: AGRBear on March 24, 2005, 08:34:58 AM
Not everyone reads the DNA thread, so, I thought I'd talk a little about it here, too.

For a more complete answer go on over and take a look.  You might find it interesting.

AGRBear
Title: Re: New study questions identity of Romanov bones
Post by: lexi4 on April 09, 2005, 01:09:30 AM
Helen & Belochka
Thank you so much for publishing your article on this site. I learned so much from all the posts on this thread. I am not a scientist, but I could follow your DNA discussion without a problem. I think that is a testament to your writing. I will probably read this all again because I am sure I didn't absorb it all with only one reading. This is exactly the kind of discussion I was hoping to find when I joined the Palace. It made me think, gave me some things to add to my reading list and helped me put to rest any questions I had about what happened to the IF. Thank you.
Title: Re: New study questions identity of Romanov bones
Post by: Elizabeth on May 18, 2005, 01:53:36 PM
I now this thread hasn't been "active" for a few months, but now that I'm on the board, I have some questions (especially about GD "Elizabeth" or the "finger").  Also, I know one of the posts directed the individual to "the article," but I can't seem to locate it.

1.  First of all, was there evidence that the finger was taken off of GD Elizabeth's hand (either in the mine or as a relic).  Interestingly (and it might already have been discussed), but her "hand" was traveling around Russia last year to be venerated by the faithful.

2.  Also, re: the discussions about if that is "really" GD Elizabeth in the grave on the Mount of Olives, I recall reading in ONE of my many books on the IF that the coffin eventually found its way to Cairo, where it was met by one of Elizabeth's and Alexandra's sisters (Irene maybe?), who wrote to their brother, Ernie.  In her letter to him, she said something (and I'm paraphrasing here) that "her body was not corrupted, and it looked as if she were sleeping."  Surely, her own SISTER would have "seen" the difference between her own sister and the nun, Barbara?

Just some thoughts . . .

E--
Title: Re: New study questions identity of Romanov bones
Post by: Elisabeth on May 18, 2005, 02:28:14 PM
Quote
2.  Also, re: the discussions about if that is "really" GD Elizabeth in the grave on the Mount of Olives, I recall reading in ONE of my many books on the IF that the coffin eventually found its way to Cairo, where it was met by one of Elizabeth's and Alexandra's sisters (Irene maybe?), who wrote to their brother, Ernie.  In her letter to him, she said something (and I'm paraphrasing here) that "her body was not corrupted, and it looked as if she were sleeping."  Surely, her own SISTER would have "seen" the difference between her own sister and the nun, Barbara?


The only problem with this scenario is that the photographs of the corpses at Alapaievsk by White investigators clearly show that the remains of both Elizabeth and Sister Barbara were grotesquely swollen (i.e., corrupt, please forgive me for saying so) beyond any immediate or easy recognition.

It begs the question whether the corpse buried at the Mount of Olives is really Elizabeth's or that of someone else.

Title: Re: New study questions identity of Romanov bones
Post by: Robert_Hall on May 18, 2005, 02:43:56 PM
So much that has been written about Ella is so devotional, emotional and reverential romanticism it is hard to take it objectively.
Title: Re: New study questions identity of Romanov bones
Post by: Elizabeth on May 18, 2005, 02:51:05 PM
I understand your point, Robert (in fact, it's a VERY IMPORTANT point).

However, my concern is that we're talking about someone who has been sainted by both ROCOR and the Russian Orthodox Church (in Russia), and I thought they were a little "hesitant" about granting sainthood to bones they "weren't really sure" were the real thing (the IF's remains come instantly to mind).  

If there were only TWO women in the mine who were killed, then that narrows it down considerably, in that ONE of them has to be Elizabeth (maybe it's just not the one in the coffin marked with her name).  But, again, I would have thought the Church would have checked that out.

Nevertheless, it's a fascinating (but disturbing) twist.

E--
Title: Re: New study questions identity of Romanov bones
Post by: etonexile on May 18, 2005, 08:50:26 PM
3..."3" independant testing labs show that the remains of the persons found in Siberia are related to a known relation of the IF...Prince Philip...these are the type of labs which routinely find the killers of children by a single hair...or release a person from death row after 30 years because the DNA was not a match....These labs are serious,scientific organizations...3..."3"...
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on May 18, 2005, 10:46:41 PM
Quote

The only problem with this scenario is that the photographs of the corpses at Alapaievsk by White investigators clearly show that the remains of both Elizabeth and Sister Barbara were grotesquely swollen (i.e., corrupt, please forgive me for saying so) beyond any immediate or easy recognition.


Unfortunately the images in O'Conor's book appear to be touched up. In my possession there is a set of clear images of their remains that appeared in a fairly recently published Russian source (2000).

The photograph labelled as G.D. Elizaveta Fedorovna clearly shows that her face was covered by a cloth. This feature is not clear in the translated O'Conor book (see Image # 137 between pp 226-231). The chin is exposed and does appear somewhat decomposed.

The right hand is also mostly covered by a small piece of cloth - which obscures the real position of the hand. Only segments of two digits are exposed - whether the hand is closed or open is difficult to discern. Her left hand is also obscured by a similar small piece of cloth, but there are two digits clearly protruding.   

From a modern investigative perspective it is unfortunate that the purported photograph of Ella reveals the least amount of forensic detail, when compared to the other series of photographs.

The second female body was photographed without additional coverings postmortem.

Each body photographed at the crime scene does demonstrate varying degrees of decomposition.



Title: Re: New study questions identity of Romanov bones
Post by: lexi4 on May 18, 2005, 11:15:32 PM
Belochka,
Which book do you have?
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on May 19, 2005, 12:06:10 AM
Quote
Belochka,
Which book do you have?


Hi lexi4,

It is not a book, but a Russian periodical called RODINA, 2000/8 in an article titled Poslednii Marshrut [Final Route] by Luidmila Likova, pp 2 - 5
Title: Re: New study questions identity of Romanov bones
Post by: LayLay on January 29, 2006, 05:49:18 PM
interesting
Title: Re: New study questions identity of Romanov bones
Post by: Belochka on January 29, 2006, 08:46:23 PM
Quote
So much that has been written about Ella is so devotional, emotional and reverential romanticism it is hard to take it objectively.


I agree with you Robert.

If these elements were set aside in the interests of genuine forensic evaluation, we could learn the truth about the state of "Ella's" remains.