Author Topic: DNA RESOURCEs: Romanov-related scientific papers  (Read 253568 times)

0 Members and 1 Guest are viewing this topic.

Offline AGRBear

  • Velikye Knyaz
  • ****
  • Posts: 6611
  • The road to truth is the best one to travel.
    • View Profile
    • Romanov's  Russia
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #30 on: February 21, 2005, 09:49:57 AM »
If FS was murdered then she could not have been AA.  That's pretty simple.  And, according to the Berlin police and court, who convicted Grossmann for her murder in 1921, FS was one of his victims.

It isn't a matter of believing or disbelieving the mtDNA, if FS was murdered then people are going to have to look for other possibilities.

AND, if FS and Gertrude had different mothers, then this also means your mtDNA will need other possibilities.

Your right, not all the facts will ever be collected, however, there are new discoveries  that need to be reviewed.

Slaming the door behind the mtDNA test is fine for some of you, I , however, am looking at the possibilities of new found evidence.  After all these years,  I don't mind waiting a little longer to see what the new discoveries are.

Again,  I have no investment in AA being FS....  To me, if AA was FS then so be it.   So, there is no need to think I'm after anything but the truth.

AGRBear
« Last Edit: December 31, 1969, 06:00:00 PM by AGRBear »
"What is true by lamplight is not always true by sunlight."

Joubert, Pensees, No. 152

Offline AGRBear

  • Velikye Knyaz
  • ****
  • Posts: 6611
  • The road to truth is the best one to travel.
    • View Profile
    • Romanov's  Russia
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #31 on: February 21, 2005, 10:05:40 AM »
Quote

Bear, if you have origianl information from Atlantis against AA=FS, i would appreciate if you could post the pictures or type the text. I will also try to find it from library. I may have to adjust my estimante of 0.00001% depending on the context.


The information we had on this forum was from Penny.  However, due to something which occured while I was gone last week, Penny has pulled all of her posts.  This was a terrible lost of information, like that of her quest to discover the new evidence about FS.

Like you and everyone else,  we'll have to wait until Penny and Greg can publish this data.

Since they are well known and have published books and have their Atlantis,  it's not as if their suggestions is just some idle promise.

I for one am greatly disturb at the lost of Penny and other posters who had considerable about of information from which all of us could have benifited.

So, here I am,  trying to make sure that the readers understand that  despite what some claim, this mystery remains open to debate and isn't closed.

AGRBear
"What is true by lamplight is not always true by sunlight."

Joubert, Pensees, No. 152

Denise

  • Guest
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #32 on: February 21, 2005, 10:50:01 AM »
Quote

The information we had on this forum was from Penny.  However, due to something which occured while I was gone last week, Penny has pulled all of her posts.  This was a terrible lost of information, like that of her quest to discover the new evidence about FS.

Like you and everyone else,  we'll have to wait until Penny and Greg can publish this data.

Since they are well known and have published books and have their Atlantis,  it's not as if their suggestions is just some idle promise.

I for one am greatly disturb at the lost of Penny and other posters who had considerable about of information from which all of us could have benifited.

So, here I am,  trying to make sure that the readers understand that  despite what some claim, this mystery remains open to debate and isn't closed.

AGRBear


I understand that the loss of information to the site is a terrible thing.  Penny made her choice to leave.  Many things that she said to others could be construed as attacks, particularly the final exchange with Jeremy.  

We need to get past Penny leaving and woek with what we have.  

One thing to consider Bear, is that despite the possibility that FS was murdered by Grossman, this evidence was apparently not brought into the AA court case.  Per PK's book, there are no instances of people saying "this is all a moot point as FS is dead by Grossman's hand."  In  fact, the judge ruled that AA was not AN and was most likely FS.  

Grossman was not convicted of ONLY FS murder.  It was a series of murders as there were 3-4 butchered young women in his apartment when he was arrested.

Offline AGRBear

  • Velikye Knyaz
  • ****
  • Posts: 6611
  • The road to truth is the best one to travel.
    • View Profile
    • Romanov's  Russia
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #33 on: February 21, 2005, 11:02:44 AM »
I don't know the answers about what was said in the AA's trial or what references were made about FS.

It's true, Grossmann was convicted of many murders, one of which was said to have been FS.

Like I said,  I don't mind waiting for Penny's discoveries.

AGRBear

« Last Edit: December 31, 1969, 06:00:00 PM by AGRBear »
"What is true by lamplight is not always true by sunlight."

Joubert, Pensees, No. 152

helenazar

  • Guest
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #34 on: February 21, 2005, 11:04:19 AM »
Quote

Grossman was not convicted of ONLY FS murder.  


Was Grossman convicted for FS's murder at all? I don't think so. It sounds like it was just speculation that she was one of the victims and that they never concluded that she was killed by him. If they had really concluded that FS was killed by Grossman, then her name would have never came up as a candidate for AA's identity later on in court. If they seriously thought that FS was in fact killed by him, they would never had gone 35 years later through the trouble and expense of DNA testing of FS relatives in order to show that AA may have been FS. If the serial killer theory was in any way conclusive in 1919, we wouldn't even be having this conversation today about whether AA was FS or not... This is just my opinion.

Denise

  • Guest
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #35 on: February 21, 2005, 11:09:16 AM »
Quote

Was Grossman convicted for FS's murder at all? I don't think so. It sounds like it was just speculation that she was one of the victims and that they never concluded that she was killed by him. If they had really concluded that FS was killed by Grossman, then her name would have never came up as a candidate for AA's identity later on in court. If they seriously thought that FS was in fact killed by him, they would never had gone 35 years later through the trouble and expense of DNA testing of FS relatives in order to show that AA may have been FS. If the serial killer theory was in any way conclusive in 1919, we wouldn't even be having this conversation today about whether AA was FS or not... This is just my opinion.


Not to my knowledge.  And few of the websites even mention AA.  The few that mention AN or AA at all say that he killed Anastasia while she was in the disguise of a Polish factory worker named FS.  Crazy, hey??

helenazar

  • Guest
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #36 on: February 21, 2005, 11:19:46 AM »
Quote

No Helen, it doesn't require statistician to validate the number. IMHO, it is intellectually lazy to stick to the obviously outdated number.  


Dave, I didn't say we shouldn't update the old stats, the reason I said we should stick with the old numbers is to be really conservative in what we say about this, until we can definitely show that the new numbers are legit. Since, as you said, none of this has been peer reviewed or published, it's always best to stay with the old numbers until that happens or until we can in some way validate the new numbers. I think what you have presented is perfectly legit and most probably accurate.

Quote
The test, which shows AA's mtDNA  and  Karl Maucher as a relative tells us only that, they were relatives.  It means AA was related and this range, I'm told, can be within 10 to 25 generations.
 

I am still wondering what the source of this information is (the "10 to 25 generations"). We keep hearing about it, but I don't think anyone ever provided the exact reference for where these numbers came from.  I think Penny may have mentioned that it was from the Sykes book, but I couldn't find it and she did not give a page number. Does anyone know? I don't know if we should accept these numbers as gospel truth until we see the reference...  For the purpose of this particular thread, everything stated here should be referenced or else we will have to disregard it.

helenazar

  • Guest
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #37 on: February 21, 2005, 11:27:30 AM »
Quote
 The few that mention AN or AA at all say that he killed Anastasia while she was in the disguise of a Polish factory worker named FS.  Crazy, hey??


Wait a minute, let me get this straight: the literature that claims that FS was killed by Grossman also says that Grossman killed Anastasia disguising as a Polish factory worker named FS? Well, that's the first time I am hearing this one! So now they are saying that AA and FS were two different people but that FS was Anastasia, and not AA? Well, this is absolutely priceless  ;D.  And we are supposed to take this "serial killer" theory seriously? ::)

Denise

  • Guest
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #38 on: February 21, 2005, 11:28:03 AM »
Quote

I am still wondering what the source of this information is (the "10 to 25 generations"). We keep hearing about it, but I don't think anyone ever provided the exact reference for where these numbers came from.  I think Penny may have mentioned that it was from the Sykes book, but I couldn't find it and she did not give a page number. Does anyone know? I don't know if we should accept these numbers as gospel truth until we see the reference...  For the purpose of this particular thread, everything stated here should be referenced or else we will have to disregard it.


The way I understood this Helen, is that because mtDNA mutates every 10-25 generations, and AA matches CM, that means they share a maternal ancestor within the past 10-25 generations since their DNA matched.

I have no idea if this is accurate or not, just the  way I have interpreted what I read.

Offline AGRBear

  • Velikye Knyaz
  • ****
  • Posts: 6611
  • The road to truth is the best one to travel.
    • View Profile
    • Romanov's  Russia
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #39 on: February 21, 2005, 11:29:43 AM »
Quote

Not to my knowledge.  And few of the websites even mention AA.  The few that mention AN or AA at all say that he killed Anastasia while she was in the disguise of a Polish factory worker named FS.  Crazy, hey??


This is a new one.  Where did you read this?

As for the numbers of 10 to 25,  I thought that was the  numbers some of you were bouncing around as the fiqure of relationship with  AA if FS  and Gertrude had different mothers.

I've said what I've had to say.

Now,  this old bear is just going to wait patiently for answers to those two basic questions:
(1)  Is there more evidence that Grossmann killed FS?
AND
(2)  Did FS and Gertrude have different mothers?

AGRBear
"What is true by lamplight is not always true by sunlight."

Joubert, Pensees, No. 152

Denise

  • Guest
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #40 on: February 21, 2005, 11:32:03 AM »
Quote

Wait a minute, let me get this straight: the literature that claims that FS was killed by Grossman also says that Grossman killed Anastasia disguising as a Polish factory worker named FS? Well, that's the first time I am hearing this one! So now they are saying that AA and FS were two different people but that FS was Anastasia, and not AA? Well, this is absolutely priceless  ;D.  And we are supposed to take this "serial killer" theory seriously? ::)



Let me clarify my source here--it wasn't a book.  I did a Google search to see if there were any web pages about Grossman.  There were SCADS!!  but none mentioned FS or AA, except for 2 or 3.  And the references there were as I stated above.  

I guess to my mind, if it had been proved beyond a doubt that Grossman killed FS (who, while not historically significant, but still important) someone somewhere would have made note of it online.  

And Bear's book, while a reputable source, is 40 years old.  So who is to say if it was put out in a new edition today, that the author would still say Grossman killed FS, now that we have the DNA evidence on the FS--AA--CM connection??

Denise

  • Guest
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #41 on: February 21, 2005, 11:36:10 AM »
Quote

This is a new one.  Where did you read this?



Just explained that one, Bear!  :)

Quote



Now,  this old bear is just going to wait patiently for answers to those two basic questions:
(1)  Is there more evidence that Grossmann killed FS?


Not really.  Seems that he has been relegated to an oddities among serial killers category, as he sold the meat of his victims.

Quote

(2)  Did FS and Gertrude have different mothers?

AGRBear



I truly don't think so.  I believe that when finding a member of the Schanzkowsy family to obtain a DNA sample from, the researchers were meticulous enough to get a good sample.  

And if they did, obviously they were maternally related, as the DNA matched....

Offline AGRBear

  • Velikye Knyaz
  • ****
  • Posts: 6611
  • The road to truth is the best one to travel.
    • View Profile
    • Romanov's  Russia
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #42 on: February 21, 2005, 11:55:28 AM »
Here is one of the posts where the numbers was mentioned:

Quote
I won't go into the great detail as we have before, but here is the nutshell.
DNA is a sequence of chemicals, represented by the letters A,G,T.C.  They form long chains, so a DNA sequence looks like this:
GAAATTCGGGAATCCTAGGAGATATCTA  (notice this is where the movie "Gattaca" gots its name)

There are 2 kinds of DNA, nuclear and mt. Nuclear DNA is absolutely unique to each individual on the planet, with the possible exception of identical twins.  your nuclear DNA is different from your closest siblings, very similar, but there are differences. THIS is why nuclear DNA evidence is in fact almost 100% conclusive in Courts.  

Now, mtDNA is different.  It comes from the mitochondrial cell and is passed directly from mother to child.  All descendants in a maternal line have the exact same mtDNA.  We know all European families come from those orignal women, because they all have "almost" identical codes. Now, there are times where a letter in code gets changed by random, this is called a "mutation".  Scientists have discovered that ONE mutation change occurs once in 25-35 GENERATIONS.  Prince Philip's mtDNA exactly matched the mtDNA of the females in the Ekaterinburg grave, but Anna Anderson's mtDNA showed five different mutation differences, meaning that the closest maternal relation to Queen Victoria was 5x25 generations before.  

Hope this makes things a bit more clear. also, DNA is not a "mantra" is science, provable over and over again by anyone who does the work, no different than the theory of flight or why an xray works


AGRBear
"What is true by lamplight is not always true by sunlight."

Joubert, Pensees, No. 152

Offline AGRBear

  • Velikye Knyaz
  • ****
  • Posts: 6611
  • The road to truth is the best one to travel.
    • View Profile
    • Romanov's  Russia
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #43 on: February 21, 2005, 12:09:07 PM »
Quote

...[in part]...

...Not really.  Seems that he has been relegated to an oddities among serial killers category, as he sold the meat of his victims.



I truly don't think so.  I believe that when finding a member of the Schanzkowsy family to obtain a DNA sample from, the researchers were meticulous enough to get a good sample.  

And if they did, obviously they were maternally related, as the DNA matched....


The Berlin police told FS's family that she had been murdered by Grossmann and gave a date.  There was a trial.  I assume each count of murder which the Berlin police were aware was placed in the records.  For farther information, we'll have to wait for someone who has seen these records.

As for the mtDNA,  I am aware that the tests were done as acurately as one would expect.

I am not placing doubt on the tests at this time because I have no reason to doubt the tests.  The tests prove that AA was related to Karl Maucher and through Gertrude, the grandmother of Karl Maucher.

At this time there is doubts about the relationship between Gertrude and FS.  They may not have had the same mother.  
The question about the mothers is being researched and we'll discover, if it's possible, if Gerturde and FS did have different mothers.  It is possible that if there were two mothers who might have been related..... That would be one more step close to FS if she was not murdered.

We don't have the answers.  We may get them.  I don't know.  All we can do is wait and see.

If they did not have the same mothers and they  were not related as far as anyone knows, then we're back to Who was AA if she wasn't FS?

AGRBear
« Last Edit: December 31, 1969, 06:00:00 PM by AGRBear »
"What is true by lamplight is not always true by sunlight."

Joubert, Pensees, No. 152

Mgmstl

  • Guest
Re: DNA RESOURCEs: Romanov-related scientific pape
« Reply #44 on: February 21, 2005, 12:37:28 PM »
Bear, I agree that this Grossman issue needs to be cleared up before I am satisfied, along with the 10-25 generation that they shared a common ancestor.

My suggestion is to examine all the Grossman data available, perhaps there is a way to get the actual records. On microfilm or by photocopy.

I also want to say, the one reason I am HESITANT about having anything to do with this thread, is threats that were made on here last week.  I look at it as a situation which Penny had no choice but to respond as she did, after being threatened with a lawsuit.  Which was beyond ridiculous.  I don't see it as totally her fault at all, quite the opposite IMO.  

We have lost a valuable source,  and her input was invaluable, IMO.  Perhaps she can be persuaded to return in due time.  

We do need further information on Grossman, and the police records on who his victims were.  I for one would like to see the police conclusions on his victims, and if they believed that this was indeed FS.